1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
2 years ago
5

Select the correct answer.

Biology
2 answers:
ddd [48]2 years ago
3 0

Answer:

can I have the picture?

Explanation:

I don't get it

motikmotik2 years ago
3 0
2 is the answer tattcattgtta
You might be interested in
Indicate whether the following outcomes of cell division are observed in mitosis only, meiosis only, or both mitosis and meiosis
serious [3.7K]

Answer:

A. Both in mitosis and meiosis (II)

B. Mitosis

C. In both

D. Meiosis

E. Mitosis

Explanation:

Prior to every case of cell division in both mitosis and meiosis, the cell always ensures to duplicates its contents including its chromosomes. In both cases of cell division, the sister chromatids separates, apart from in meiosis I where homologous chromosomes separates to opposite poles. Only one cellular division occurs in mitosis which is involved in the growth and development of the diploid individual but in meiosis, two divisions takes place in the gametes (both male and female) to ensure that the haploid number of chromosomes is transfered from both parents each to the offspring ensuring a constant diploid offspring. Thus a diploid parent cell always produces a haploid daughter cell in the gametes during meiosis. In mitosis, the daughter cells are always identical to the parents cells.

4 0
3 years ago
Select all that apply.
vitfil [10]
Nitrogen is not necessary <span />
7 0
2 years ago
Read 2 more answers
Where does the oxygen used in cellular respiration end up?
xz_007 [3.2K]

Oxygen used in cellular respiration ends up in ATP Synthesis in Oxidative Phosphorylation.

Explanation:

Since oxygen is the last electron acceptor in Electron transfer chain, the H ions flow through ATP synthase for ATP synthesis. The electrons from the NADH and FADH are pumped from the matrix of mitochondria to inter-membrane space. The energy released due to the proton gradient formed is used for making ATP.

3 0
2 years ago
PLEASE HELP ME WITH THIS QUESTION
Brut [27]

Answer:

D

Explanation:

5 0
3 years ago
Read 2 more answers
Is there a cure for sickle cell disease
Dmitriy789 [7]

Answer:

I dont think it can not be cure Bone marrow transplant, also known as stem cell transplant, offers the only potential cure for sickle cell anemia. ... As a result, treatment for sickle cell anemia is usually aimed at avoiding crises, relieving symptoms and preventing complications.

hope it helps!

7 0
3 years ago
Other questions:
  • What caused England's Biston betularia moth populations to change over time from light colored to dark colored?
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • WILL GIVE A BRAINLEST AND 20PTS
    8·2 answers
  • A great deal of the Blue Ridge was eroded. The eroded rock eventually finally settled in Virginia’s coastal plain. What process
    14·1 answer
  • Bone contains living cells and organic matter such as collagen, protein, and polysaccharides. However, much of the volume of bon
    7·1 answer
  • A team of scientists placed five rocks in five separate, artificial environments. All the rocks came from the same formation and
    10·1 answer
  • Activators are proteins that bind to regions of DNA and increase the rate of transcription of specific genes. Repressors, on the
    7·1 answer
  • What is the answer for “make ribosomes (RNA)
    6·1 answer
  • What is the type of chemical weathering caused by oxygen in the atmosphere called
    15·1 answer
  • Please help I’m begging you please
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!