1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
8

The constellation gemini is only visible from earth several months of the year because

Biology
1 answer:
Oduvanchick [21]3 years ago
3 0
<span> Gemini will be visible almost 9 months, Other times it will be visible at night sometimes, due to the earths rotations only certain constellations are see able at one time. </span>
You might be interested in
1. cells are the basic units of________and_______in all living things.
Ludmilka [50]

Answer:

1. Life, exist 2. pre-existing cells.

Explanation:

3 0
3 years ago
Which stage is the last stage of speciation?
gtnhenbr [62]

Answer:

The populations become adapted to different environments and eventually become so different that they cannot interbreed to produce fertile offspring.

Speciation is the evolution of one species into two different kinds, and when they become isolated, that is the final step, since they cannot interbreed any longer.

8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Please answer this question quickly!!!
Julli [10]

Answer:

B

Explanation:

8 0
3 years ago
The classification system developed by Linnaeus in the early 1700s divided living organisms into plant and animal kingdoms. Toda
dybincka [34]
One of the main reasons why there is a need to create additional three kingdoms was due to the invention of the microscope. The scientific device paved way for a more intensive study of the tiny organisms most considered as single-celled which cannot be seen by the naked eye. 
6 0
3 years ago
Read 2 more answers
Other questions:
  • Stretch marks are the result of tears in the integumentary layer that contains fibrous connective tissue, elastin, and collagen.
    10·2 answers
  • Which is an example of insurance fraud?
    9·2 answers
  • Which of the following would likely reduce the threats posed by exotic species to native species?I. Increasing inspections of go
    10·1 answer
  • What is the difference between covalent and iconic bonding's
    6·2 answers
  • Marine organisms that are euryhaline would most likely be found in which environment?
    8·1 answer
  • What is hypertension and what are some factors that affect it?
    11·1 answer
  • Which contains the greatest variety of cell types
    6·1 answer
  • Place the steps shown below in the correct order.
    7·1 answer
  • What happens to pyretic acid in the Krebs cycle???, ANSWER AND ILL PUT U ON BRAINLIEST
    9·1 answer
  • Use the drop-down menus to complete the sentences about air pollution. the burning of causes dangerous gases to enter the atmosp
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!