1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
2 years ago
10

Pls help!!! which one is the answer?

Biology
1 answer:
Aleksandr [31]2 years ago
3 0

Answer:

i think its the first one because i found this information that makes sence

Explanation:

Restriction enzymes are used in biotechnology to cut DNA into smaller strands in order to study fragment length differences among individuals. This is referred to as restriction fragment length polymorphism (RFLP). They're also used for gene cloning.

You might be interested in
Based on the arrows, what does the image represent?
Karolina [17]

Answer:

I think the answer is B i might be mistaken though c:

Explanation:

4 0
3 years ago
(Giving brainliest!!)
slega [8]

Answer:

when you look a streetlight from far it will be some how not bright. the other stars are far from planet earth . but the  sun is near

Explanation:

3 0
2 years ago
A constant rate of increase (rmax) for a population produces a growth graph that is J-shaped rather than a straight line. Why?
Alexus [3.1K]

Answer:

Explanation:

The line graph illustrates the temperatures in London, New York and Sydney on monthly average and the table introduces the information about the annual hours of sunshine for these cities. The overall view is that London is always exceeded by the rest in both the temperature and the number of sunshine hours.

To specify, the line graph shows that in New York, the average temperature goes up slightly from 4.5 degree in January to 8 degree in March, before a more significant increase to the highest of 30 degree in July, followed by a drop to 5 degree in December. Similarly, in London, after climbing gradually from the lowest point of 9 degree to the highest of 23 degree in July, the figure stays unchanged in the next month and then fall to 9.5 degree in December.

On the contrary, in Sydney, the temperature decrease insignificantly from 25.5 degree in January to the lowest of 16 degree in July, before a gradual rise to 25 degree in December. Meanwhile, the table indicates that New York has the largest number of sunshine hours per year with 2535 hours, came after by Sydney and London with 2473 hours and 1180 hours respectively.

In conclusion, London is likely to be the coldest city because its annual hours of sunshine is less than two others.

7 0
2 years ago
Read 2 more answers
Which of the following statements from a describes the weather
vodomira [7]
Um your question is very unclear lol
7 0
2 years ago
What kind of molecule is used by organisms to store and transmit genetic material?
hoa [83]
Genetic material, wouldn't that make it DNA? I took Biology last year so it's a little hard for me to remember but I think it is DNA.
4 0
3 years ago
Other questions:
  • What is an example of something that moves but is not alive?
    11·1 answer
  • What evidence did Galileo use to support Copernicus’s model and disprove Aristotle and Ptolemy? Select two options.
    9·2 answers
  • In the development of the cell theory, Schleiden and Schwann did not study prokaryotes. Why might this have limited their unders
    10·2 answers
  • 9. Your boss at Wendy's says you will receive a raise if you sell over 60% of the fries that are in the cooler. There are 230 po
    13·1 answer
  • How can water affect the rock cycle?
    7·1 answer
  • What is the law of the universal ?
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The repeated movement of certain substances between organisms and the atmosphere is called a(n)
    9·1 answer
  • Morning commuter traffic in cities contributes to ____ smog. In this type of air pollution, a mixing of ____ from certain plants
    6·1 answer
  • Anyone wanna talk I’m bored
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!