1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
12

Name two earth spheres that interact in the following situation:

Biology
1 answer:
Varvara68 [4.7K]3 years ago
8 0
Maybe biosphere and geosphere?
You might be interested in
Low-density lipoproteins (ldl) are the principal transport vehicle for _____ in the blood.
aleksley [76]

Low-density lipoproteins (LDL) are the principal transport vehicle for cholesterol in the blood.

The body needs cholesterol, a waxy, fatty molecule, in the proper proportions for overall health. High blood cholesterol is a disorder that can result from unfavorable cholesterol levels. Low-density lipoprotein (LDL), also known as "bad" cholesterol, is the type of lipoprotein that carries cholesterol in your blood.

Cholesterol is primarily brought on by consuming fatty foods, failing to exercise regularly, being overweight, smoking, and using alcohol. Moreover, it can run in families. By consuming a healthy diet and increasing your physical activity, you can lower your cholesterol. Some folks also require medication. The majority of the cholesterol in your body is LDL (low-density lipoprotein), also referred to as "bad" cholesterol. Your risk of heart disease and stroke increases if your LDL cholesterol levels are high.

To know more about low-density lipoprotein refer to:  brainly.com/question/9041034

#SPJ4

7 0
1 year ago
Which common medication is extremely toxic to cats?
DochEvi [55]
<span>Aspirin/Paracetamol/Ibuprofen are all extremely toxic to cats when an incorrect dose is given. Whilst common medication can be beneficial to some animals when given in the correct dose, it can also be highly dangerous. For example, one normal-strength tablet of paracetamol is highly toxic for a cat, and another just a day later will prove fatal.</span><span />
7 0
3 years ago
Different flavors of a gene are called?
inna [77]

Answer:

Different flavors of a gene are called alleles

5 0
3 years ago
Read 2 more answers
Earthquakes occur because
lora16 [44]
Earthquakes are usually caused when rock underground suddenly breaks along a fault. This sudden release of energy causes the seismic waves that make the ground shake. When two blocks of rock or two plates are rubbing against each other, they stick a little.
8 0
3 years ago
What does a flower grow from? A stem, a leaf, or a bud?
Illusion [34]
From a stem or a bud

5 0
4 years ago
Read 2 more answers
Other questions:
  • How has technology chamged farming
    7·1 answer
  • Under the Clean Air Act, science is the foundation for setting health-based air quality standards for certain common air polluta
    10·1 answer
  • Natural resources a. are inputs provided by nature. b. include land, rivers, and mineral deposits. c. take two forms: renewable
    11·1 answer
  • Data from a Burger et al. (2004) indicate that mercury levels in Florida gar, top-level predators, from Lake Okeechobee were not
    6·1 answer
  • The seeds of flowering plants, angiosperms, have similar parts. The part of the seed that is responsible for protecting the deve
    5·1 answer
  • A lot of points marking people as BRIANLIST
    13·2 answers
  • For centuries, certain animals have been crossed to produce offspring with desirable qualities.
    6·1 answer
  • Can you answer 66 and 67 and 67 please I’ll venmo 2 cause I’m broke just drop your venmo
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Compare the structures of arabinoxylan and amylopectin. [5 marks]
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!