1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RUDIKE [14]
2 years ago
5

Please help answer this question, thanks

Biology
1 answer:
Pie2 years ago
8 0
A- head
C- shoulder blade
D-biceps
You might be interested in
A biologist at a highly prestigious biology conference presented an informative speech on how DNA in genetics works. All audienc
Arada [10]

The question is incomplete as it does not have the options which are:

A. novelty

B. creativity

C. consensus

Answer:

A. novelty

Explanation:

Novelty refers to a qualitative identity that is used to represent the new ideal things or some fresh and refreshing ideas.

In the given question, the person who was presenting about the idea of How DNA works in genetics? failed to present something new about the DNA and just presented what was already known to the audience.

Since the presenter failed to express the new ideas in his presentation about the DNA that is no novel ideas were presented therefore the audience started to leave the presentation.

Thus, Option-A is correct.

3 0
3 years ago
State the five requirements for a population to be in Hardy-Weinberg equilibrium.
mihalych1998 [28]

When it comes to population evolution and genetics, we cannot fail to cite the Hardy-Weinberg principle which emphasizes that if evolutionary factors such as natural selection, mutation, migration and genetic oscillation do not act on a particular population, the frequencies genotypic proportions will remain constant.

The five requirements for a population to be in Hardy-Weinberg equilibrium are:

  • Large-scale breeding population: For a population to be in Hardy-Weinberg equilibrium, it is important that this population is large, as small populations favor genetic drift (unanticipated fluctuations in allele frequencies from one generation to another).
  • Random mating: In order for the Hardy-Weinberg equilibrium to occur, it is necessary that the mating occur at random, with no preference for certain groups within the population. In this case, we say that the population is in panmixia, that is, they all mate at random.
  • No mutations: Mutations alter the total alleles present in a population (gene pool). Therefore, in a Hardy-Weinberg equilibrium population, no mutations should occur.
  • No gene flow: When there is gene flow due to migration or immigration of individuals, some genes may be included or excluded from the population. Thus, in an equilibrium situation, no gene flow occurs.
  • Lack of natural selection: For a population to be in Hardy-Weinberg equilibrium, natural selection must not be acting on it. If natural selection acts, some genotypes will be selected, modifying the allelic frequencies of the population.

5 0
3 years ago
Is food code an administrative law, federal law, or state law
Alecsey [184]

Answer:

administrative law

Explanation:

i learned this

6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
1.<br> How much thermal energy is required to melt 4.525 mol of ice at 0°C to liquid water at 0°C?
svetoff [14.1K]
Formula to create heat of fusion (hof) i q=m•/\Hf
to get the amount of heat energy you need to
however much you have gxj/g
find J
6 0
3 years ago
Other questions:
  • Organic matter in soil is also called ______.
    5·2 answers
  • Organisms in the same ecosystem are all _______.
    10·1 answer
  • What are 5 potential jobs that a students of neurology can obtain?
    11·1 answer
  • It is likely that Earth could lose half of its species in the next ____________ years.
    7·2 answers
  • A gated channel in a cell membrane allows
    12·2 answers
  • Through_ , larger molecules are formed​
    9·1 answer
  • What quantity can tell you wether a solution is acidic or basic
    9·1 answer
  • REALLY EASY!!! JUST CAN'T CHOOSE !!!! WILL GIVE BRAINLIEST!!!! AT LEAST TAKE A LOOK!!! ANSWER IF 100% SURE THO!!!
    7·1 answer
  • You work in a lab that is studying PIWI proteins. You isolate piRISCs from cells. Based on what you know about how piRISCs silen
    11·1 answer
  • What is immigration?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!