1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lana71 [14]
3 years ago
7

How do you think the first cell came into existence? (using your own words.) (2 sentences)

Biology
2 answers:
lara31 [8.8K]3 years ago
6 0

Answer:

It has been hypothesized that there were four steps that occurred to create the first living cell:

1. The Abiotic (Nonliving) synthesis and accumulation of small organic monomers like amino acids or nucleotides

2. The Joining of monomers into polymers

3. The origin of an effective, low-risk method of replication ( RNA World )

4. The self-assembly of molecules into droplets that had chemical characteristics inside different from the environment outside.

zalisa [80]3 years ago
3 0

I think that the enclosure of self-replicating RNA in a phospholipid membrane. The first cell is thought to have arisen by the enclosure of self-replicating RNA and associated molecules in a membrane composed of phospholipids.

You might be interested in
If a man weighs 190 lb and eats 150 g protein per day, his protein intake is _____ of the recommended dietary allowance (rda)
-BARSIC- [3]

The RDA for protein is 0.8 g per kilogram of body weight. This man's weight is 190 lb, or 86 kg; 86 kg × 0.8 = 69.1 g protein per day. Thus, an intake of 150 g is more than twice his RDA of 69.1 g of protein per day.

Recommended Dietary Allowance (RDA) of protein for adults is 0.8 g per kilogram of body weight. To determine your RDA for protein, multiply your weight in pounds by 0.36.The protein RDA for adults is 0.8 grams per kilogram of healthy body weight per day.

Proteins build muscle mass and contour, facilitate hair, nails and bone growth, regulate energy levels, and support chemical processes within the body which include enzyme, hormone and antibody production.

To learn more about Recommended Dietary Allowance ,here

brainly.com/question/11824881

#SPJ4

6 0
2 years ago
What biome is treeless, has 2 seasons, has an average precipitation level of 6-10 in ( less than 25 cm) per year, and has an ave
Mariulka [41]
The answer is: C-Tundra
7 0
2 years ago
Read 2 more answers
13.) A skier on a ski lift is making her way to the top of the ski mountain. As the skier moves higher a. The kinetic energy bei
erik [133]

Answer:

gravitational potential energy

The skier possesses gravitational potential energy at the top of a slope, which transforms into kinetic energy as he moves down the slope.

3 0
3 years ago
A change in the sequence of bases in a DNA molecule is know as
Ymorist [56]

Answer:

A point mutation is a change in the base sequence of a DNA molecule.

Explanation:

8 0
2 years ago
Read 2 more answers
which ecoregion of Texas is most likely to be affected by wind erosion ?f. East Texas Piney Woods G. rolling plains H. Blackland
sweet [91]
F. east texas piney woods
8 0
3 years ago
Read 2 more answers
Other questions:
  • What are the consequences of high levels of fertilizing chemicals in water?
    14·1 answer
  • What happens to an animal cell if too much water enters the cell via osmosis?
    7·1 answer
  • Which process takes place in the mitochondrion?
    9·1 answer
  • The release of charged particles when salts dissociate in water results in a solution that can conduct electricity. Thus, these
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is a second order consumer
    8·2 answers
  • I lived on a small indonesian island around 18 kya. i used stone tools to hunt animals, but i had a very small cranial capacity
    8·1 answer
  • What is the dominant phase in the life cycle of an angiosperm ?​
    7·2 answers
  • A red blood cell is placed into a sugar water solution. The red blood cell has a lower concentration of protein and sugar than t
    14·2 answers
  • Which type of medication treats a sprained ankle that exhibits pain, redness, and heat?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!