1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
2 years ago
13

2. What is the difference between parasitic roots and mycorrhizae?​

Biology
1 answer:
LUCKY_DIMON [66]2 years ago
5 0

Answer:

the main difference between the paasitic roots and mycorrhizae is that the parasitic roots are adventious roots of parasitic plants penetrating into the conducting tissue of the host plant whereas mycorrhizae r the association's between fungi and higher plants

You might be interested in
Which of the following scientists did not contribute to the cell theory? A. Virchow B. Hooke. C. Schleiden D. Newton
zhannawk [14.2K]
D is the correct answer i believe hope this helps!!




Plz mark as brainlist and five star it would mean alot!!!
8 0
3 years ago
Read 2 more answers
Different forms of a given gene are known as what
Lemur [1.5K]

Answer:Alleles

Explanation:

7 0
3 years ago
When a plant is not strong enough to support its own weight what is most likely the problem
Whitepunk [10]

Answer:

the roots are weak

Explanation:

because it can’t hold its weight

8 0
3 years ago
How remote sensing works and why it is important in cartography
AleksandrR [38]

Advanced technologies like remote sensing have modified the way by which maps are constructed. Remote sensing is the procedure of collecting information about Earth with the help of instruments mounted on airplanes, satellites, or ships.  

Remote sensing helps in monitoring and detecting the physical features of a region by determining its emitted and reflected radiation at a distance from the targeted region. Unique or specialized camera gather remotely sensed pictures of the Earth that assists the researchers in sensing the things about the Earth.  


5 0
3 years ago
Toxicology is the study of the negative effects of __ on living things
BartSMP [9]
Toxicology is the study of poison on living things
3 0
3 years ago
Read 2 more answers
Other questions:
  • During osmosis, the semi-permeable membrane is one that: A. allows only very small particles or water through. B. allows only ve
    10·1 answer
  • Do dogs have Endocrine Respiratory Circulatory Digestive Skeletal Muscular Nervous ​Urinary systems
    12·1 answer
  • If you want to improve your muscular endurance, what is the best plan?
    14·2 answers
  • 1. Predict Two photographers take time-lapse
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In pea plants, there is a dominant gene that causes some plants to be unnaturally tall. Another dominant gene causes flowers to
    14·1 answer
  • The cell body that contains the nucleus, which includes DNA and other structures that support the neuron, is called the
    15·1 answer
  • How do researchers most often investigate the
    12·1 answer
  • What is Roosevelt trying to accomplish with this fireside chat?
    6·2 answers
  • ____ is a dimness of vision or the partial loss of sight without detectable disease of the eye
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!