1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Afina-wow [57]
3 years ago
7

Which of the following takes place in the light-dependent reactions of

Biology
1 answer:
Fantom [35]3 years ago
5 0

Answer:

b) Energy is Captured.

The sunlight is converted to chemical energy

go for it!!

You might be interested in
Which of the following are characteristics of organisms in the Kingdom Plantae? *
GaryK [48]
Kingdom Plantae includes all the plants on the earth. They are multicellular, eukaryotes and consist of a rigid structure that surrounds the cell membrane called the cell wall. Plants also have a green coloured pigment called chlorophyll that is quite important for photosynthesis.
8 0
3 years ago
How are lettuce epidermal cells different to onion cells?
AlexFokin [52]
They both have an egg cell wall, a vacuole, and chloroplast, smooth and rough  ER, and much more.
Onion skin is treated to be a tissue because it is thin and - brittle.
The skin cells of the onion get a well which gives- the outer portion its rigid shape.
5 0
3 years ago
6. Marcus's genotype for eye color is bb. Olivia has brown eyes, but she is heterozygous for the trait.
Sidana [21]

Answer:

i believe that the awnser is A

Explanation:

6 0
3 years ago
Read 2 more answers
On a dichotic listening task, A. people can accurately monitor two tasks at the same time, except when the tasks are both audito
RideAnS [48]

Answer:

B. people notice little about the message that they are supposed to ignore

Explanation:

In dichotic listening task people are able to concentrate on one voice while ignoring the other. It is observed that during dichotic listening task people concentrate more on one task than other. Sometimes dichotic listening task is used to examine the selective attention of brain. In the test the person is subjected to two voices simultaneously over the headphones and asked to pay attention either one or both voices. Then he is aked questions about the content.

Example; If you are talking on the phone with someone in a room  filled with voices of other people, you would be able to listen and concentrate at the voice on the phone while ignoring the other voices because of dichotic listening.

Example; If you are attending a seminar of a psychology professor and some peoples are talking in the hall you would be able to concentrate on the voice of the professor because of dichotic listening.

7 0
3 years ago
Rocks can melt without changing temperature when the pressure exerted on them is
never [62]
By low temperature, it can melt. High pressure will raise the  melting point of the rock.  
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following cell parts are NOT found in BOTH plant and animal cells? A. mitochondria
    12·1 answer
  • If an element has 4 electrons, how many of them will be in the second energy level?
    14·1 answer
  • "skin cells perform very different functions compared to brain cells. on the molecular level, what makes skin cells different fr
    13·1 answer
  • [Quick][easy question]
    14·2 answers
  • 1. In the atom, which particles are in constant motion around the nucleus?
    15·1 answer
  • During which phase of the cell cycle does the cell prepare for mitosis?
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What that determines if a cell is eukaryotic. *
    15·2 answers
  • PLEASE HELP EXAM IN PROGRESS
    12·1 answer
  • What is the addition of mass called
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!