1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yaroslaw [1]
3 years ago
14

Puromycin is an antibiotic. Its effect is to force the ribosome to detach from the mRNA chain before reaching the stop codon. Ex

plain why this would have a harmful effect on a bacterium.
Biology
2 answers:
DIA [1.3K]3 years ago
6 0

Answer:

Please find the explanation below

Explanation:

Transcription and translation are the two proocesess involved in gene expression. These two processes are important because the end result is a PROTEIN responsible for the phenotypic characteristics of that organism. Transcription involves synthesis of mRNA from DNA while translation involves synthesis of protein from mRNA.

In this question, an antibiotics called Puromycin forces the ribosome to detach from the mRNA chain before reaching the stop codon. This means that the antibiotics "Puromycin" abruptly truncates the translation process. Hence, proteins will not be produced. This means that the organism (bacteria) will not be functionally active because of lack of necessary PROTEINS.

Mekhanik [1.2K]3 years ago
3 0

Answer:

It would prevent something from oding its action, which would disrupt the process

Explanation:

You might be interested in
What term generally describes small chunks of rocks and debris in space?
Fiesta28 [93]

When in space it is a meteorite. When it is entering the atmosphere, it is a meteor. When it hits the earth it;s classified as a meteoroid.


Hope this helps.

3 0
4 years ago
Read 2 more answers
Earths inner core:__as earth's outer crust:liquid​
Dahasolnce [82]

Answer:

The earth is made up of three different layers: the crust, the mantle and the core. This is the outside layer of the earth and is made of solid rock, mostly basalt and granite. There are two types of crust; oceanic and continental. Oceanic crust is denser and thinner and mainly com​posed of basalt. The inner core is made from Iron and Nickel.

Explanation:

7 0
3 years ago
Humans use great amounts of synthetic pesticides and herbicides in their lawns and gardens. These toxic chemicals can contaminat
katrin [286]
The answer is C. It eliminates the toxic chemical problem. Hope this helps!
7 0
3 years ago
All organisms must obtain energy from their environment. every organism needs this energy in order to grow and reproduce. how do
Mkey [24]
<span>They capture energy from sunlight and manufacture their own food</span>
4 0
3 years ago
A scientist studies the formation of the protein hemoglobin. Arrange the labels to complete the steps for the formation of hemog
julsineya [31]

Correct Answer:

C, D, A, B

Explanation:

I took the test using the person's above answer, got 2 wrong, therefore it's C, D, A, B, instead of C, A, D, B.  

I hope this helps

3 0
3 years ago
Read 2 more answers
Other questions:
  • This is formed as a waste product in photosynthesis and used as a reactant in respiration.
    14·1 answer
  • What are the products of photosynthesis?
    14·1 answer
  • Which of the following represents nitrogen as it would most likely be found in the atmosphere?
    6·1 answer
  • Discuss the theories of opening and closing stomata​
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • For what purposes does phytoplankton use carbon dioxide?
    6·1 answer
  • Please no links or files or I will report
    14·2 answers
  • Compare and contrast plant-like and animal-like protists.
    9·1 answer
  • What term is used to describe how well an organism functions in its
    15·2 answers
  • One scientific principle involved in soap production<br>​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!