2 years ago

Please heeeeeeeeeeeeeeeellp

Biology

1 answer:

a_sh-v [17]2 years ago

5 0

Answer:

⇔⇔

Explanation

↓∵∴

You might be interested in

Which of the following codes for a specific protein?<br> DNA<br> Gene<br> Enzyme<br> Chromosome

Sholpan [36]

The answer is DNA which cods for spesific protein

7 0

2 years ago

What is the fluid found in the extracellular matrix that holds cells together as tissue and allows them to communicate with one

garri49 [273]

The fluid inside of the Extracellular Matrix is Extracellular Fluid. Extracellular Fluid is also called ECF. ECF is mostly tissue fluid. It is also made up of a large amount of intravascular fluid. The remaining smaller amount of ECF is transcellular fluid.

hope i could help :)

4 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

A gardener accidentally trims the leaves of a green plant too short. The leaves are now much smaller. He notices that the plants

nordsb [41]

In my opinion, it would be C.

6 0

3 years ago

Difference between palisade cell and fungi hypha cell

dlinn [17]

Palisade cells are a specific type of plant cell. They have chloroplasts and do most of the photosynthesis in the leaf. Because palisade cells are plant cells, they also have the differences always found between plant and animal cells. They have a cell wall; animal cells have only a cell membrane.

5 0

2 years ago