1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
13

under which conditions will plant cell mitochondria actively oxidize pyruvate and carry out oxidative phosphorylation?

Biology
1 answer:
Novay_Z [31]3 years ago
6 0

Cellular respiration has three stages: glycolysis, the Krebs cycle and oxidative phosphorylation. The Krebs cycle represents the oxidation of pyruvate.

  • The plant cell mitochondria actively oxidize pyruvate and carry out oxidative phosphorylation in ALL cells, with or without light.

  • Pyruvate is produced during glycolysis and then this molecule is oxidated in the mitochondrial matrix in order to produce energy (ATP).

  • Oxidative phosphorylation refers to the synthesis of ATP through an electron transport chain which is coupled to the generation of an electrochemical proton gradient.

  • In aerobic organisms such as plants, cellular respiration is fundamental for all their cells.

  • On the other hand, light-dependent reactions and light-independent reactions are photosynthetic reactions, which occur in plant chloroplasts.

Learn more in:

brainly.com/question/11437461?referrer=searchResults

You might be interested in
Which of the following can affect the function of a cell?
liberstina [14]

D) All of above

<em>Hope this helps!</em>

7 0
3 years ago
Read 2 more answers
Walking with muscular dystrophy is described as...
Alja [10]
The person would first have trouble walking, and soon have trouble taking care of him or herself's basic needs.
7 0
3 years ago
The parent of an 8-month-old infant tells the nurse, "while administering the medication to my child, i add a small amount of ho
Tpy6a [65]
<span>The 8 month old infant is at risk for an allergic reaction. You should never give a child under the age of one any honey. The nurse should inform the parent that giving honey to a child under the age of one is dangerous and can cause an allergic reaction.</span>
3 0
3 years ago
Read 2 more answers
7) True or False: All plants need the same amount of sun<br> to make enough food to be healthy.
timama [110]

False, many plants are sensitive to sunlight depending on the plant

5 0
3 years ago
NEED ANSWER ASAP
Paul [167]

Answer:

the answer would be A

Explanation:

Animal cells are oval and egg shaped so we can cancel out c and d

A is the correct answer because we can see green dots within the structure. Chloroplasts contain a green pigment called chlorophyll. This green pigment makes the chloroplast and the structure green (as we can see in the picture). Photosynthesis occurs in the chloroplasts, and it is where the plant gets its glucose from

Hope this helps!

8 0
2 years ago
Other questions:
  • How does population density differ from population size? a.Population size takes all organisms into account, while population de
    15·2 answers
  • Identify 2 characteristics of the alveoli that facilitate gas exchange and infer their significance for their process
    8·2 answers
  • Why do some investigations require a control
    6·2 answers
  • Which function is specific to the neuron?
    15·2 answers
  • Pleaseeee heelppp me
    8·2 answers
  • What is the basic structure of a cell membrane?
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What type of molecule is rna polymerase
    13·1 answer
  • Which bone is not present in all five fingers?
    8·2 answers
  • A new predator of rabbits has been introduced within an ecosystem. This new predator runs faster than the native predators of ra
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!