1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
10

How is cellulose formed within living organisms

Biology
1 answer:
ipn [44]3 years ago
4 0

Answer:

when many glucose monomers bond together

Explanation:

You might be interested in
Which of the following IS found in a bacteria cell?
Paha777 [63]
A procaryotic cell has five essential structural components: a nucleoid (DNA), ribosomes, cell membrane, cell wall, and some sort of surface layer, which may or may not be an inherent part of the wall.
5 0
3 years ago
The fossil record supports which of the following descriptions of the
Ivahew [28]

Answer:

Complex organisms evolved from more simple organisms

Explanation:

<em>Fossil records support the fact that complex organisms evolved from more simple organisms.</em>

<u>Fossils are remains of organisms that have been naturally preserved in rock forms. </u>

The study of fossilized remains of organisms has enabled scientists to establish the fact that earlier organisms are simple types and more complex organisms arose from them through a gradual process of change, otherwise known as evolution. Carbon dating of fossils enables scientists to establish the year the organism existed.

7 0
3 years ago
Which concept was proposed by Darwin? Which concept was proposed by Darwin? ocean warming natural selection ecosystem structure
dem82 [27]

Answer:

Natural selection.

Explanation:

Natural selection was the theory "survival of the fittest"

7 0
3 years ago
Please Help! A.S.A.P!! Will Mark Brainliest!
saveliy_v [14]

Answer:

Newer layers of earth form <u>on</u><u> </u><u>top</u> of older layers, so as we dig, we can see further back in time. Comparing the fossils between the layers can offer evidence of change.

<u>Phyletic</u><u> </u><u>gradualism</u> - slow, but constant gradual change; supported by transitional species in the fossil record

<u>Punctuated</u><u> </u><u>equilibrium</u>- long periods of no change followed by short periods of rapid change.  Can also be supported by the fossil record when no transitional species are found.

6 0
3 years ago
Read 2 more answers
The plasmodesmata in plants are functionally most similar to which animal cell junction?
morpeh [17]

Answer:

B.) Gap junction

Explanation:

Plasmodesmata (singular form: plasmodesma) are intercellular organelles found only in plant and algal cells. (The animal cell "equivalent" is called the gap junction.)

5 0
2 years ago
Other questions:
  • If you have an element with atomic no of 3 and 14 nuetrons how many what would be the atomic mass
    13·1 answer
  • Organelle that captures light energy and converts it to chemical energy through photosynthesis
    12·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Are skin and/or bone an organ?
    6·1 answer
  • An organism occupying the 3rd trophic level is best described as a ________. tertiary consumer secondary consumer top carnivore
    12·1 answer
  • What are the standard units of specific gravity?
    7·1 answer
  • Help please! Science.
    8·2 answers
  • Your pet snake would be found in what kingdom?
    7·2 answers
  • NEED ANSWERED ASAP The food webs below model relationships among the organisms in two ecosystems. Which ecosystem would be more
    11·1 answer
  • What can you predict will happen to the ocean currents as the ice caps melt?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!