1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesna [10]
3 years ago
13

Please Help! A.S.A.P!! Will Mark Brainliest!

Biology
2 answers:
saveliy_v [14]3 years ago
6 0

Answer:

Newer layers of earth form <u>on</u><u> </u><u>top</u> of older layers, so as we dig, we can see further back in time. Comparing the fossils between the layers can offer evidence of change.

<u>Phyletic</u><u> </u><u>gradualism</u> - slow, but constant gradual change; supported by transitional species in the fossil record

<u>Punctuated</u><u> </u><u>equilibrium</u>- long periods of no change followed by short periods of rapid change.  Can also be supported by the fossil record when no transitional species are found.

kirza4 [7]3 years ago
6 0

Answer: Newer layers of earth form on top  of older layers, so as we dig, we can see further back in time. Comparing the fossils between the layers can offer evidence of change. Phyletic gradualism  slow, but constant gradual change; supported by transitional species in the fossil record Punctuated equilibrium long periods of no change followed by short periods of rapid change.  Can also be supported by the fossil record when no transitional species are found. hope this helps p :) but, i just looked up the sentences and it gave me the answers.

You might be interested in
The gene for curled ears is dominant over the gene for straight ears (e). If you crossed a cat with curled ears (Ee) and a cat w
galben [10]

Answer:c

Explanation:

7 0
3 years ago
_______________ can be accidental or intentional, and it can cause erosion.
maksim [4K]
Fire can be accidental or intentional, and it can cause erosion.
3 0
3 years ago
Read 2 more answers
1. C3N2H4<br><br> 2. AIBr3<br><br> 3. C6H5F<br><br> 4. CrO3<br><br> 5. H2O2<br><br> 6.C12H22O11
MakcuM [25]
A. Organic compounds - C₃N₂H₄ , C₆H₅F and C₁₂H₂₂O₁₁

Organic compounds are compounds which have Carbon except few compounds such as carbon dioxide, cyanide. Other than Carbon, other elements also present such as Hydrogen, Oxygen and Nitrogen. But Carbon is considered as the main element of organic compounds. 

B. Inorganic substances - AIBr₃ , CrO₃ and <span>H</span>₂<span>O</span>₂

Inorganic substances are the compounds which do not own C-H bonds. Most inorganic compounds do not have carbon as their element except few. (Cyanides, carbon dioxide, carbon monoxide and so on are considered as inorganic although they have carbon).
6 0
3 years ago
Why are the intestines the largest parts of the alimentary canal?
anygoal [31]

The parts of the alimentary canal listed in order are the mouth, pharynx or throat, esophagus, stomach, small intestine and large intestine. The alimentary canal is the digestive system and includes the parts of the body with which food comes in contact from eating to waste elimination.

8 0
3 years ago
Read 2 more answers
Give one difference between the structure of the bacteria cell and animal cell
Verizon [17]
Hello!
You can choose the difference! 

Bacterial cell is 0.2 to 2 um in size, while an animal cell is 10-100 um in size
Bacterial cells are made up of murein, while animal cells don't have a cell wall
Bacterial cells dont posses a nucleus, while animal cells do posses one.

There are more differences, but these are the biggest.
<span>Hope this helped you!</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the significance of stem cells in the process of meiosis (i.e., what are they there for?)
    10·1 answer
  • The light-independent reactions of photosynthesis need
    11·1 answer
  • I need help with this Punnett square Practice
    9·1 answer
  • Which of the following personal health practices should a person follow to prevent heart diseases?
    12·2 answers
  • a cactus with long spines protects itself from animals better that a cactus with short spines. according to natural selection, _
    14·2 answers
  • How do the changes in heat and pressure, along with the changes in composition, serve to explain the changes in physical propert
    11·1 answer
  • Which of the following distinguishing living things from nonliving things
    14·1 answer
  • Refracting telescopes can be much larger than reflecting telescopes.
    9·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • During science and technology class, Hank’s teacher is leading a discussion on North America’s search for more eco-friendly ener
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!