1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
11

On the hawaiian islands, evidence indicates that the 50 species of plants in the the "silversword alliance" all arose from a sin

gle immigrant plant. the plants in the "silversword alliance" are extremely diverse and include trees, shrubs, lianas and other herbaceous plants. this is an example of adaptive radiation.
Biology
1 answer:
4vir4ik [10]3 years ago
6 0
It is true. The Mauna Kea Silversword is highly endangered flowering plant endemic which is Hawaii island. Mauna Kea silversword is a member of the silversword alliance. The group has fifty species in the three genera of endemic Hawaii islands.
It is an erect, monocarpic single-stemmed, basically wordy herb, spirally arranged. The leaves are being covered with a dense layer of long silvery hairs, the leaves have essential ability to store water as a gel in the intracellular spaces whereby the other plants leaves they contain air in them.
You might be interested in
Which of the processes of the water cycle car by releasing energy?
arsen [322]
Condensation, because when water vapor turns into water again it needs to release energy to do so. Its like turning ice into water again. 

I hope this helped ^_^
3 0
4 years ago
Which statement describes the function of cholesterol in membranes?
Lorico [155]
I believe its A. I may be wrong.
4 0
3 years ago
What a water pollution<br> plz hurry
Jet001 [13]

Answer:

pollution of water. or do you mean pollutant in which case would be like garbage or oil spills

6 0
3 years ago
Read 2 more answers
Write a sentence that compares the reactants and products of photosynthesis with the reactants and products of respiration.
Anna11 [10]

Answer/Explanation:

Using solar energy, photosynthesis uses carbon dioxide and water to produce glucose and oxygen, whereas respiration uses glucose and oxygen to produce energy, releasing carbon dioxide and water.

Therefore, photosynthesis and respiration act as a cycle, using reverse reactants and products.

Photosynthesis builds food for the cell to use, respiration uses this food to power cellular processes.

5 0
3 years ago
Adjacent animal cells maybe bound together by _______, _______, and _______.
zubka84 [21]
Tight junction, Gap junction, Desmosomes
3 0
3 years ago
Other questions:
  • Y=x2-1. Is it linear
    11·2 answers
  • At what stage in C. elegans does cell differentiation occur?
    13·2 answers
  • Why are some people shy? I will mark Brainless
    12·2 answers
  • An order is subdivided into several _____. divisions classes families species
    14·2 answers
  • Wind energy takes _____
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Is a Heterotroph a araebacteria or a eubacteria
    13·1 answer
  • In the solid phase , molecules are completely separate from each other
    6·1 answer
  • NO LINKS AND NO GUESSES I WANT A COMPLETE ANSWER
    6·1 answer
  • How to get fake fever​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!