1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
9

Define photosynthesis???​

Biology
2 answers:
stellarik [79]2 years ago
8 0
Photosynthesis is a process which plants and organisms use sunlight to synthesize foods from carbon dioxide and water.
8090 [49]2 years ago
5 0

photosynthesis the process by which green plants and some other organisms use sunlight to synthesize nutrients from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a by-product.

▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪

<h3>Answered by:-</h3><h2>Cutest Ghost</h2>

▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪▪

You might be interested in
Plz help me answer this
Katarina [22]
All of the above is the correct answer
8 0
3 years ago
Read 2 more answers
PLS HELP DONT HAVE MUCH TIME
ipn [44]

I believe the answer is A

8 0
3 years ago
HELP ASAP NOW!
Tpy6a [65]

Answer:

The reason is because the moon's orbit about the earth is about 5 degrees off from the earth-sun orbital plane. However, at special times during the year, the earth, moon, and sun do in fact "line up". When the moon blocks the sun or a part of it, it's called a solar eclipse, and it can only happen during the new moon phase.

Explanation:

Maybe don't yell at us

5 0
2 years ago
Fats are broken into saturated fats and unsaturated fats. Which of these explains the difference between saturated and unsaturat
alekssr [168]

C) saturated fats have only single bonds on all the carbon atoms


hope this helps :)

6 0
3 years ago
Which of the following might have influence whether or not a comet will collide with a nearby planet
Sonja [21]
Gravitational attraction between two celestial objects (i think)
8 0
3 years ago
Other questions:
  • What part of cell theory did schleiden and schwann disagree about?
    13·2 answers
  • Would balanced force be the correct answer.Need fast.
    10·1 answer
  • Xylem and Pholem are examples of _______________Plant cells function together to form______.
    7·1 answer
  • The purpose of the Human Genome Project was to
    9·1 answer
  • What is the main difference between a cell nucleus and a nucleoid?
    5·2 answers
  • In general, sympatric speciation requires the action of _____ selection acting against hybrids.disruptivedirectionalecologicalar
    5·1 answer
  • What is the role of RNA? a.to provide the original blueprint for protein production b.to move information from the ribosomes to
    5·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How would someone with diabetes know they need medical help?
    5·1 answer
  • What process involves making RNA based on the sequence of nucleotides 12
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!