1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
10

Which factors influence ocean currents? Select the three correct answers.

Biology
2 answers:
anastassius [24]3 years ago
7 0

Answer:

the answer is the wind because of its force

Lubov Fominskaja [6]3 years ago
4 0

Answer:

it would be B.wind because it would cause everything including tornadoes

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
If fruit flies are still used today what can happen?
ICE Princess25 [194]

Answer:

You may not think that Fruit Flies pose a health risk but they are insects and all insects pose a health risk if they hang around long enough.

Explanation:

8 0
3 years ago
Read 2 more answers
Compare biomes of North Africa and iceland
Travka [436]

Answer with Explanation:

"Biome" refers to the flora (plant life) and fauna (animal life) of a particular place. It also includes the climate and specific conditions that allow the living organisms in the environment to survive.

The biome of North Africa consists of both desert biome and rainforest biome. It can be classified into a "savannah biome." This means that both the grassland and the woodland co-exist with each other. On the contrary, the biome in Iceland consists of a "tundra biome." The appearance of this biome is uniform and it is considered the coldest among all the other biomes.

Both of the biomes in North Africa and Iceland are different owing to their temperature, precipitation, nutrients from the soil and so on. The savannah biome consists of both wet and dry climates. These seasons allow the growth of both trees and grasslands. When it comes to the tundra biome, its temperature is extremely low. Thus, it doesn't allow many plants or trees to grow. However, it allows the growth of some unique types of wildlife such as the "Arctic fox."

3 0
3 years ago
How can you distinguish between animal and plant cells under the microscope?
IRISSAK [1]

Answer:

the shape

Explanation:

If it’s round it would be animal and if it’s square-like it would be plant cell. Hope this helps!

4 0
2 years ago
Light changes direction slightly when passing from one substance to another?
DochEvi [55]
When a ray passes<span> from air into glass the </span>direction<span> in which the </span>light<span> ray is traveling </span>changes<span>. ... This bending of a ray of </span>light<span> when  </span>passes from one substance<span> to </span>another substance<span> is called refraction. Hope this helps!!!</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Compare the energy flow in photosynthesis to the energy flow in cellular respiration.
    6·1 answer
  • What are the internal and external regulators?
    6·2 answers
  • Similar DNA sequences in genes can be evidence of A. binomial nomenclature. B. mutations. C. common ancestry. D. different anato
    9·1 answer
  • Screenshot attached below
    7·2 answers
  • What is the role of xylem in a vascular plant?
    12·2 answers
  • put the steps of the nitrogen cycle in order starting with the step that removes nitrogen from the atmopshere
    6·1 answer
  • Why is ""Climate Change"" a more accurate description of the increase in Earth’s temperature than ""Global Warming""? A. it is u
    15·1 answer
  • Viruses cause disease like : (a) dysentery (b) malaria. (c) hepatitis B. (d) tuberculosis
    7·1 answer
  • Directions: Read the case study: Complete a summary of the case study in 3-5
    7·1 answer
  • I still dont understand life lol
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!