1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnyKZ [126]
2 years ago
5

Exam number: 986210RR

Biology
2 answers:
Tju [1.3M]2 years ago
4 0

Answer:

organs

Explanation:

if we don't have organs we will not survive

Artemon [7]2 years ago
4 0

Answer:

D

Explanation:

Organ is formed when a group of tissues works together to perform a common function

You might be interested in
A roller coaster car rapidly picks up speed as it rolls down a slope. As it starts down the slope, its velocity is 4 m/s. But 6
damaskus [11]

Answer:

i think the answer is -7

Explanation:

4 - 46 = -42       -42\6 is -7  i dont know if its right

5 0
3 years ago
What does semiconservative replication refer to?
forsale [732]

Answer:

it is a

Explanation:

Both strands are new in each new DNA molecule.

6 0
2 years ago
What happens to chromosomes during metaphase?
wel

Answer:

Hello,

I hope this helps!

chromosomes that carry genetic information align in the equator of the cell before they split off into two daughter cells

Explanation:

During metaphase, the chromosomes that carry genetic information align in the equator of the cell before they split off into two daughter cells with identical genetic material. Metaphase is the third stage of mitosis, which is a phase of the cell cycle where chromosomes in the nucleus are divided between two cells.

7 0
2 years ago
Which statement correctly describe one similarity between cellular respiration and photosynthesis?
Vitek1552 [10]
B. Plz follow and brainliest
7 0
2 years ago
Need help i don't understand
zzz [600]

Answer:

Cells can die because they are damaged, but most cells die by killing themselves. Some cell death processes leave no trace of the dead cell, whereas others activate the immune system with substances from the dead cell.

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • Compare and contrast inbreeding and hybridization
    14·1 answer
  • What separates the oral cavity from the nasal cavity when raised and in contact with the posterior pharyngeal wall?
    15·1 answer
  • Will an increase in water temp damage aquarium plants
    8·1 answer
  • A mother of a 7-year-old child complains to the nurse that her child wets the bed at night. upon interaction with the child, the
    10·1 answer
  • What are the sections of aquifers?
    9·1 answer
  • If your high power objective is 40x and your eyepiece is 15x, the total magnification is _____x.
    6·1 answer
  • 5 of 8 Review Living organisms make and use three main types of ribonucleic acids (RNA) for their biological functions: ribosoma
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What type of bond occurs between the nitrogenous bases?
    11·2 answers
  • Which evolved first, photosynthesis or cellular respiration?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!