1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Travka [436]
2 years ago
12

What is the data collected during an experiment

Biology
2 answers:
Marta_Voda [28]2 years ago
7 0

Answer:

<em><u>The dependent variable.</u></em>

Explanation:

hope this helps u!!

jarptica [38.1K]2 years ago
5 0

The dependent variable is the data we collect during the experiment. This data is collected as a result of changing the independent variable.

You might be interested in
Write a caption to describe the events shown in the illustration.
Inga [223]

Answer:

the plasma is go out from the capillaries, therefore the capillary is incomplete because in the capillaries the plasma is recused, So the plasma is create illustration

8 0
3 years ago
What letter represents the biological level for community?
Veseljchak [2.6K]

Answer:

I don't know much but try D srry I'm not good at it

6 0
3 years ago
Read 2 more answers
A(n) ________ is a chamber that isolates the subject from the external environment.
coldgirl [10]
<h3><u>Answer;</u></h3>

A skinner chamber

A <u>skinner chamber</u> is a chamber that isolates the subject from the external environment.

<h3><u>Explanation;</u></h3>
  • A skinner chamber or skinner box an enclosed chamber which contains a bar or key that an animal can press or manipulate in order to obtain food or water as a type of reinforcement.
  • <em><u>This box was used by Skinner in his experiments concerning Operant conditioning. From the experiments that he conducted he realized that the important part of any operant conditioning id recognizing the operant behavior and the outcome resulted in that particular environment.</u></em>
4 0
3 years ago
Read 2 more answers
Energy is transferred when
inna [77]
It's either species eat or populations evolve. Think about the food chain, about how it transfers energy through organisms.
3 0
3 years ago
In the block to polyspermy, entry of the sperm's contents causes ________ levels in the oocyte's cytoplasm to rise, triggering t
crimeas [40]

In the block to polyspermy, entry of the sperm's contents causes calcium ion levels in the oocyte's cytoplasm to rise, triggering the cortical reaction.

In biology, polyspermy describes the fertilization of an egg by more than one sperm. Diploid organisms normally contain two copies of each chromosome, one from each parent.

The cell resulting from polyspermy, on the other hand, contains three or more copies of each chromosome—one from the egg and one each from multiple sperm. Usually, the result is an unviable zygote. This may occur because sperm are too efficient at reaching and fertilizing eggs due to the selective pressures of sperm competition.

The cortical reaction is a calcium-dependent exocytotic process in which the content of secretory granules is released into the perivitellin space immediately after fertilization, which serves to prevent polyspermic fertilization.

Learn more about  polyspermy here : brainly.com/question/4537960

#SPJ4

8 0
1 year ago
Other questions:
  • The timeline best illustrates that
    5·2 answers
  • What is meant by the phrase “natural selection is location specific”
    9·2 answers
  • No matter which biome we examine, there is ALWAYS one group of organisms that is the nonmobile base for the biome's food web: th
    13·2 answers
  • Which one of the following statements correctly describes how stream terraces can form? Group of answer choices A temporary base
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the difference between thylakoids and granum
    7·1 answer
  • How many organ there are in the immune system?!
    12·1 answer
  • Results in science are not generally accepted as being accurate until they can be verified. Which of the following is an example
    13·2 answers
  • Answer Under 20 minutes and I give Brainiest!!
    13·2 answers
  • Single Strand Binding Proteins are responsible for:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!