1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Temka [501]
2 years ago
12

What is tonopoly? answer this please ​

Biology
1 answer:
Iteru [2.4K]2 years ago
3 0

Answer:

a dominant position of an industry or a sector by one company, to the point of excluding all other viable competitors.

You might be interested in
If the specific gravity of urine is 1. 020 in the sample of urine, what caused the filtrate to increase its s. g. between bowman
frutty [35]

Because more water than solutes are reabsorbed between Bowman's capsule and the collecting duct, specific gravity rises.

<h3>What is bowman's capsule?</h3>
  • The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup and surrounds the glomerulus.
  • The "Bowman's space," which is adjacent to the proximal convoluted tubule of the nephron and signifies the beginning of the urinary space, is enclosed by Bowman's capsule.
  • The glomerulus is protected by a two-walled pouch called Bowman's capsule.
  • Bowman's space is the term for the area between the capsule's walls.
  • The glomerular capsule, the Malpighian capsule, and the renal corpuscular capsule are among additional names for Bowman's capsule.
  • The Bowman's capsule is a portion of the human kidney's nephron.
  • By permitting water molecules and tiny molecules of other substances to flow through its selectively permeable membrane, Bowman's capsule performs the ultra-filtration process.
  • Thus, glomerular filtrate is formed.

Learn more about bowman's capsule here:

brainly.com/question/20694510

#SPJ4

4 0
1 year ago
A sentence for active transport
dem82 [27]

Active transport is the moving of molecules across the membrane of the cell against the concentration gradient with the use of ATP.

Low to high concentration. Concentration gradient is the diffusion (movement of molecules from regions of low concentration) from high to low with the gradient. Active transport is from low to high, against the gradient.

4 0
3 years ago
Read 2 more answers
The biome immediately south of the Taiga is the ______.
tino4ka555 [31]

Answer:

tundra

Explanation:

8 0
2 years ago
Which of these are examples of satire? check all that apply?
Mandarinka [93]
<span>1. a magazine article exaggerating the publics extreme reaction to a celebrity
2. a funny political cartoon exposing the flaws in a new government policy
3. an ironic short story that draws attention to how unmotivated people can be</span>
4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • Meiosis is responsible for which stage in the alternation of generations?
    8·1 answer
  • Which kingdom has more more individual organisms than any of the other 5 kingdoms? (Bacteria)
    11·1 answer
  • Imagine a rock is dropped from the top of a tall building. After 2 seconds of falling, the rock's instantaneous speed is approxi
    12·1 answer
  • Which organelle packages the material used to build the cell plate in plant cells
    8·1 answer
  • The renal corpuscle is made up of ________.
    7·1 answer
  • Can you think of a real-life example of how man-made pollution affected a real ecosystem, its abiotics (e.g. temperature, water
    15·2 answers
  • Please helpp meeee!!
    15·1 answer
  • Water is transpired through stomata, but carbon dioxide also must pass through stomata into a leaf for photosynthesis to occur.
    5·1 answer
  • The process by which the surface of a microorganism is covered with antibodies and complement, rendering it more likely to be ph
    15·1 answer
  • what is the difference between segregation and independent assortment? Will give brainiest award/ 72 points
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!