1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
12

PLZ HELP WILL GINE BRAINLIST :(

Biology
1 answer:
Firlakuza [10]3 years ago
7 0

Answer:

Option one.

Explanation:

Hormones are controlled by a negative feedback loop.

You might be interested in
jak nazywa sie proces w którego wyniku powstaja chmury : a) parowanie b) skraplanie c) krzepiecie d) topienie​
Tanzania [10]

Answer: b) skraplanie

Explanation:

As part of the hydrological cycle, water is evaporated off of the surface of the earth and turns into the gaseous form of water which is water vapor. With temperatures getting colder as you go higher, the water vapor will begin to condense into water droplets in the process called Condensation.

As this happens, the water droplets will come together and begin to form clouds. This will continue till the cloud gets too heavy for the capacity of the atmosphere and will then fall as rain.

8 0
3 years ago
As you drive through mountains, radio stations get harder and harder to hear. This is because the waves must pass through the va
Zolol [24]

Answer:

diffraction

Explanation:

i dont remember any of these terms so im going off their connotations here

4 0
3 years ago
Read 2 more answers
Simplify 7 +4.5. a 55 b 6 c 27 d 16​
klio [65]

Answer: 11.5, but it would be D because it's the closet  

Explanation:

3 0
3 years ago
Part C
melisa1 [442]

Answer:

because it can change in an instant

Explanation:

4 0
3 years ago
Read 2 more answers
You observe a plant on your windowsill that is growing at an angle toward the outside. This is an example of a living thing ____
katrin2010 [14]

Answer:

response to stimuli / tropism

Explanation:

The plants and animals always respond to stimuli. It is an innate character of all living things. When a bright light falls on the eye, it closes immediately. This is responding to the stimuli. When someone touches the leaves of touch-me-not plants it closes its leaves due to the external stimuli.

The plants respond to the light. Because it does photosynthesis in the presence of light. Therefore, the leaves and branches of the plants always bend towards the light. This process is called phototropism.

Similarly, the roots of the plants move towards gravity under the ground. This is called geotropism.

Besides phototropism and geotropism, other types of stimuli are there - hydrotropism(response to the water), chemotropism(response to certain chemicals).

That's why the plants growing on the windowsill move towards outside where light comes.

7 0
3 years ago
Other questions:
  • Shawn is cooking and accidentally grabs the pan in the wrong spot and burns his hand. shawn's ability to rapidly pull his hand a
    12·1 answer
  • Explain how digestion takes place in the ruminant(cow)<br>​
    5·1 answer
  • How do enzymes weaken the bonds in substances?
    6·2 answers
  • How many kingdoms are there in the domain bacteria?
    8·2 answers
  • Why are animals important to an ecosystem?
    14·1 answer
  • (06.03 lc) what is the most common bacterial sexually transmitted infection, which left untreated can lead to pelvic pain, pelvi
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which organelle stores and transports material?
    8·1 answer
  • PLEASE HELP, i’ll give you brainliest if it’s right please
    11·1 answer
  • Which of the following statements is true?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!