1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sleet_krkn [62]
4 years ago
11

How do these effects on the gene pools lead to speciation

Biology
1 answer:
nataly862011 [7]4 years ago
7 0

Answer:

Over time, genetic changes add up in each population.

These changes may prevent individuals from each population from being able to mate successfully with each other. If this happens, the two populations are considered to be distinct species.

You might be interested in
What are outliers, and what is their value in understanding disease?
Luba_88 [7]
An outlier is the outside character who does not associate itself with thereat of the terms and problem in the sequence. 
4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
the circulaatory and respitortory system wor together to provide cells with oxygen and nutrients and remove waste products such
Leokris [45]

Your circulatory system consists of your heart, blood vessels and blood, and is responsible for transporting life-giving oxygen throughout your body. When you exercise, your body's need for oxygen increases; the harder you work out, the more oxygen your body demands.

3 0
3 years ago
Which of the following statements are safety guidelines that must be followed during this lab? Check all that apply.
Ymorist [56]

Answer:

The first three are the correct choices. The last is wrong

Explanation:

Hope this helped Mark BRAINLEST!

6 0
3 years ago
Read 2 more answers
Can someone give me the answer for both questions please:)
lina2011 [118]

Answer:

The answers are:

C danimeletion

B dna - rna - amino acid - protein - genetic expression

5 0
3 years ago
Other questions:
  • A small paragraph about how the Solar Power (solar cells, solar panels ..) will help for the future
    15·1 answer
  • Which statement best describes ecological succession?
    15·2 answers
  • What is meant by the overload principle? what is meant by the overload principle? stretching a muscle group beyond the joint's h
    5·1 answer
  • Non-photosynthesizing organisms (like humans) must obtain which three basic types of nutrients from their environment?
    14·1 answer
  • How many total, non-unique alleles are there for each gene in a population of 400 humans?
    11·1 answer
  • . How does temperature change with altitude in the troposphere?
    11·1 answer
  • Through the process photosynthesis, plants and algae transform
    14·1 answer
  • Which of the following best describes the term translation?
    5·1 answer
  • The following table lists the number and variety of organisms in
    5·1 answer
  • Please help due in 10 minutes!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!