B the origin of new matter in the steady state theory???
DNA Mutation is caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes. Thus, the correct answer is option D.
1.DNA Mutations are caused by environmental factors known as mutagens.
2.Types of DNA mutagens include radiation, chemicals, and infectious agents.
3.DNA Mutations may be spontaneous in nature.
Answer:
CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA
Explanation:
Cytosine pairs with Guanine.
Adenine pairs with Thymine.
The bony landmark that <span>can be felt and seen, and is commonly used to help determine where to give an intramuscular injection on the lateral surface of the thigh is called <u>the greater trochanter.
</u><u />The illiac crest is found on the pelvis, the lateral epicondyle is in the arm, and the remaining options are too small to be felt and seen. So the correct answer has to be the greater trochanter found on the femur, or the thigh bone.<u>
</u></span>