1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
2 years ago
7

Most _____ are crops like corn, goldenrod, or clover.

Biology
2 answers:
Kobotan [32]2 years ago
7 0
Most mesophytes are crops like corn, goldenrod, or clover.
lesya692 [45]2 years ago
7 0

Answer:

Mesophytes

Explanation:

Corn, goldenrod, or clover are examples of mesophytes.

Mesophytes are the species of plants that survive in regions with moderate environmental conditions.  Their body structure consists of well-developed fibrous roots and branched stem.  

Mesophytic species of plants include the following

a) Agricultural crops

b) Plants and trees grown in garden

c) Flowering trees like deciduous  trees

Among, the given options corn and clover are  agricultural crop while golden rod is a garden flowering plant.

Thus, most mesophytes include crops like corn, goldenrod, or clover.

You might be interested in
Jill takes her children to play in the park every afternoon. she notices that since the city changed their landscaping service,
sleet_krkn [62]

Excessive application of fertilizer

The reason for the pond in the center of the park to now be covered with algae is the excessive application of fertilizer.

  • A plant can really die from too much fertilizer, and excess fertilizer can cause toxic algal blooms in lakes and streams that are dangerous to people and their pets as well as other aquatic life.
  • Aquatic "dead zones" are also a result of excessive fertilizer runoff from agricultural and lawn applications in coastal areas.

<h3>What consequences might excessive fertilizer use have?</h3>
  • By increasing the soil's salt concentration, excessive fertilizer changes the soil and might harm beneficial soil microbes.
  • Over-fertilization can result in abrupt plant growth with insufficient roots to provide the plant with enough water and nutrients.

<h3>Can plants bounce back after excessive fertilizing?</h3>
  • A few straightforward procedures can save the majority of over fertilized plants.
  • Remove any fertilizer that is readily visible from the soil and plant, and let water pass through the roots to leach the fertilizer away.
  • After that, take out any damaged foliage and give your plant another meal after about a month.

To learn more about excessive usage of fertilizers visit:

brainly.com/question/27963554

#SPJ4

3 0
11 months ago
PLEASE ANSWER
Lilit [14]

Answer:

D: Some traits in certain embryos disappear as the embryo develops.

Explanation:

Please tell me if I'm wrong

8 0
2 years ago
Why is it an investment for the cell to use two ATP at the beginning of glycolysis?
Sidana [21]

It gives the cell a net gain of 2 ATP molecules for each molecule of glucose that enters glycolysis

6 0
3 years ago
Para a ocorrência de osmose, é necessário que (analise as afirmações a seguir e marque como resposta a soma dos itens corretos u
mixer [17]

Answer:

(08) and (32)

Explanation:

To make osmosis happen there has to be a difference in the concentration of solutes, between the inside and the outside of the cell. To valance this difference in concentration, water has to flow towards a place that has a higher number of solutes.

The lipids in the cell's wall make this membrane semipermeable. This allows the passage of specific components only, such as water through aquaporins. Lipids and other elements are of importance in the barrier because they maintain the cell separated from the outside, allowing it to be balanced as regards the different substances that can interact with it.

6 0
3 years ago
The four gas giants are
AnnyKZ [126]
Jupiter, Saturn, Uranus, and Neptune
7 0
3 years ago
Read 2 more answers
Other questions:
  • Light can be diffracted or scattered true or false
    5·1 answer
  • When a sound wave strikes your eardrum, it causes forced vibrations that are transferred to the __________.
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The microscope that allows the specimen to appear three-dimensional is the
    10·1 answer
  • Suppose you find a rock with a goniatite fossil and another rock with an ammonite fossil? Which rock is older? How do you know?
    9·1 answer
  • Considering the wavelengths of light shown below, the pigments in the granum absorb mainly in which range?
    15·1 answer
  • What percentage of global water is fresh water? 1% 10% 20% 25%
    7·2 answers
  • Charles darwin's theory
    12·1 answer
  • The populations decrease as you go from the bottom of the food chain to top. Why do you think is so
    9·1 answer
  • Which of the following is NOT a function of the digestive system?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!