1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DaniilM [7]
3 years ago
7

At sea level, water boils at 100ºC. At an elevation of 500 meters, however, water will boil at 98.4ºC. Why do you think elevatio

n impacts the temperature at which water boils?
Biology
1 answer:
rjkz [21]3 years ago
7 0

I think elevation impacts the temperature at which water boils because...

As the altitude increases the pressure in the atmosphere decreases. This means that when the atmospheric pressure is lower, your water will reach it's boiling point faster. (AKA: at a lower temperature.)

You might be interested in
An open-minded scientist does all of the following except
avanturin [10]
Im not for sure but i think its D if that helps any
7 0
3 years ago
Read 2 more answers
Antibiotics exploit differences in structure between prokaryotes and eukaryotes in order to selectively attack pathogenic bacter
eimsori [14]
<h2>Peptidoglycan Cell Wall </h2>

Explanation:

  • <u>A cell wall containing peptidoglycan and distinctive ribosomes</u>
  • Bacterial cell dividers are made of <em>peptidoglycan</em> (additionally called murein), which is produced using<em> polysaccharide chains cross-connected by irregular peptides containing D-amino acids</em>
  • Gram-positive microscopic organisms have a thick cell divider containing numerous layers of <em>peptidoglycan and teichoic acids</em>
  • <em>Ribosomes are small particles</em> which is related proteins that capacity to synthesize proteins and comprising of RNA
  • Proteins are needed for many cellular capacities, for example, directing chemical procedures and repairing damage
  • Ribosomes can be discovered drifting inside the appended to the endoplasmic reticulum or cytoplasm
4 0
3 years ago
Which location is most vulnerable to primary succession?
Varvara68 [4.7K]

Answer:

A. A newly paved parking lot

Explanation:

6 0
2 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
A student used the hemoglobin data to conclude that mice and shrews are more closely related than are mice and humans or shrews
Lilit [14]
<span>The student who use the hemoglobin data to conclude that mice and shrews are more closely related than mice and humans or shrew and human is quite correct. Scientists had found a way of determining the evolution histroy of animals by means of the amino acid sequence of their hemoglobin. The higher the number of related amino acids found the closer the relationship between the two organisms. There are a difference of 29 amino acid between man and mouse and a difference of 24 amino acids between human and shrew but only a difference of 5 amino acid between mouse and shrew. This shows that mouse and shrew are closer.</span>
4 0
3 years ago
Other questions:
  • Which best statement best describes what a thylakoid does during photosynthesis
    5·2 answers
  • Why are temperatures near the great lakes cooler in the summer than temperatures a few miles away?
    11·2 answers
  • How much force is needed​ to lift a 25 kg mass?
    8·1 answer
  • Overfishing of (blank)
    8·1 answer
  • Food chains and webs not only describe the order organisms are eaten, but they also describe the _____.
    10·1 answer
  • Sugges one way in which tissues and organs are similar
    6·1 answer
  • Similarities between the Frog nervous system and the human nervous system
    6·1 answer
  • 1.Explain the energetic constraints that prohibit prokaryotes from getting larger than they are. Be sure to explain the implicat
    8·1 answer
  • What would happen if I jump out of a plane without my parachute
    6·2 answers
  • What do u mean by the term inflorescence ?<br>Thank you​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!