1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
6

To check your pulse and determine your heart rate during aerobic exercise, it is best to place your index and middle fingers on

arteries located to check your pulse and determine your heart rate during aerobic exercise, it is best to place your index and middle fingers on arteries located
Biology
2 answers:
Margarita [4]3 years ago
5 0

Answer:

The best place to test the pulse is just below the base of the thumb, on the wrist.

Taya2010 [7]3 years ago
4 0
<span>The best place to test the pulse is just below the base of the thumb, on the wrist. This allows the person to continue their exercise while still being able to check the pulse rate and see if it has reached the level they are desiring.</span>
You might be interested in
An instrument that causes air to vibrate is classified as a(n) ____________.
WITCHER [35]
Aerophones I think.

oh well brainly want me to type more.
6 0
3 years ago
Read 2 more answers
Arrange the following three stars from hottest to coolest.
IrinaK [193]

Answer:

Hottest: Star P

Medium: Star R

Coolest: Star Q

Explanation:

8 0
3 years ago
What type of reproduction occurs when animals produce cloned offspring
asambeis [7]

Answer:

A sexual reproduction it is mostly send in single sel organisms

5 0
3 years ago
7.Why would a rainy year cause an increase in cases of the virus?
xxTIMURxx [149]
Because misquotes lay eggs in standing water
7 0
3 years ago
Which behavior was most likely inherited rather than learned?
Levart [38]
D because the camel would try to avoid the sun
7 0
2 years ago
Read 2 more answers
Other questions:
  • Complexity is a measure of how difficult it is to understand something. What is an example of complexity in the natural world?
    6·1 answer
  • A student from one of the research labs is having trouble preparing a slide for examination and photographing. The bacterial sli
    10·1 answer
  • Which biome is most suitable for raising crops such as corn, wheat, and oats?
    8·2 answers
  • Which organism pictures is not an autotroph
    6·2 answers
  • A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring h
    13·1 answer
  • How does a planet’s orbital radius relate to its period?
    15·1 answer
  • How many molecules of water are created when making a lipid?
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What genes direct the
    6·1 answer
  • Explain why a bone is referred to as a living tissue?​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!