Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
it can’t survive the vacuum of space, zero temperatures and radiation and the DNA may be the missing link to long distance space travel
I think the correct answer from the choices listed above is option A. Cells divide in order to maintain a surface area large enough to support their cytoplasm. When they divide, their volume decreases which enables them to obtain enough nutrient and expel wastes.
I believe the answer is 1500
