1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
2 years ago
10

Inside a muscle, bundles of single muscle fibers form __________.

Biology
1 answer:
Lunna [17]2 years ago
7 0

Answer:

Each bundle of muscle fiber is called a fasciculus (singular fascicle) and is surrounded by a layer of connective tissue called the perimysium

Explanation:

You might be interested in
Birds' beaks give us clues about their niches.
Bumek [7]

Answer:

That's correct most birds have diffrent shaped beaks for diffrent reasons for example some birds can tweezer beaks which helps to dig into the worm holes to get worms or help to drill into trees

Explanation:

3 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which is a component of the biosphere?
velikii [3]

Answer:

There are basically 4 components of Biosphere.

Explanation:

Biosphere is the collection of all ecosystems on earth and their interactions with each other. The Biosphere of earth consists the following components,

1. The Biota

All the living organisms including animals, plants, insects and bacteria is called the Biota.

2. Geosphere

Geosphere is the surface of biosphere that is composed of soil, rocks, mountains etc.

3. Hydrosphere

The hydrosphere includes all the water bodies like ocean, rivers, streams and lakes.

4. Atmosphere

Atmosphere is the climate that describes about the temperature, humidity, wind and rain fall in Biosphere.

6 0
3 years ago
What role did mycorrhizae play in the transition of plants to land?
Colt1911 [192]
Mycorrhizae are associations between fungi and the roots of plants, where the Fungi provides minerals to the plant. It enabled plants and fungi to be the first organisms to invade land successfully 430 million years ago. In most cases the relationship between host plants and the mycorrhizal fungus is mutualistic, or mutually beneficial. The Mycorrhizal fungi come into direct contact with plant roots and with the soil, adding to the plants ability to gather nutrients and water from the soil through the fungus. 
5 0
3 years ago
What are 3 things producers and consumers have in common
irga5000 [103]
They're alive, they rely on the sun, and they require water.
7 0
3 years ago
Other questions:
  • There are two populations of mice. One is large and lives on the mainland. The other is small and inhabits an island. The two po
    14·1 answer
  • What is energy?
    14·1 answer
  • An asynchronous culture is given 3H-thymidine for a period of time, usually about 30 minutes. During the labeling period, 42% of
    7·1 answer
  • A personal trainer observes a client's knees moving inward while performing the overhead squat assessment. Which of the followin
    7·1 answer
  • This image is of a human embryo. It took many weeks of development to get to this stage. Prior to this, all of the human cells w
    9·1 answer
  • Takes blood away from the heart<br> a. artery <br> b. capillary<br> c. vein
    5·1 answer
  • What elements make up carbohydrates, nucleic acids, proteins, and lipids?
    5·1 answer
  • In this class we are exploring different career options available to today's students.
    11·1 answer
  • Through the process of transformation, bacteria cells can take up plasmids that contain recombinant DNA
    15·1 answer
  • What does a Diploid refer to?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!