1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
11

How would a cell make a protein that would go into the cell membrane?

Biology
1 answer:
trasher [3.6K]3 years ago
3 0

Explanation:

Many proteins can move within the plasma membrane through a process called membrane diffusion.

This concept of membrane-bound proteins that can travel within the membrane is called the fluid-mosaic model of the cell membrane.

You might be interested in
Can someone help me please.
Ahat [919]
Do u still need help I know how to do that
7 0
3 years ago
Who discovered the monomers of nucleic acids?
Kazeer [188]

Answer:

Phoebus Levene.

Explanation:

Two types of nucleic acids are DNA and RNA. The monomers of mucleic acid contains the pentose sugar, nitrogenous bases and the phosphate group attached with the bases.

Friedrich Miescher was the first scientists who discovered the nucleic acids. He identified the nucleic acids from the bandage that contains the nuclei of white blood cells. The new compounds discovered is known as nucleic acid. But the monomers of the nucleic acids was first explained by Phoebus Levene. Different forms of nucleic acid was also postulated by Phoebus Levene.

Thus, the answer is Phoebus Levene.

4 0
3 years ago
Read 2 more answers
What is the basic unit of classification and is denoted by a unique two-part scientific name?.
ludmilkaskok [199]

Species is the basic unit of classification denoted by a unique two-part scientific name.

<h3>What is meant by species? </h3>

Species is a name given to a group of organisms which have similar individuals. They are capable of reproducing among themselves and thus exchanging genes among themselves.

Species is the lowest of taxa and is thus the most basic unit of classification. Genus is the next taxonomic rank of the next taxa on the hierarchy of classification.

It is estimated that on earth, there are 8.7 million species living currently. This concept of species is from the times of Aristotle.

Therefore, species is the basic unit of classification denoted by a unique two-part scientific name.

Read more about species, here

brainly.com/question/13259455

#SPJ4

4 0
2 years ago
4. How to determine fats and oils in simple method?
DedPeter [7]

Answer:

5.Triglycerides are a type of fat. They are the most common type of fat in your body. They come from foods, especially butter, oils, and other fats you eat. ... Your body changes these extra calories into triglycerides and stores them in fat cells. When your body needs energy, it releases the triglycerides.

6.High LDL cholesterol increases your risk for heart disease and stroke. Weight gain. Many high-fat foods such as pizza, baked goods, and fried foods have a lot of saturated fat.

7.provide energy , primary form of energy storage , insulate and protect

4 0
3 years ago
Read 2 more answers
What are the conditions required for natural selection? Check all that apply.
aleksley [76]

reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population.

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the purpose of transcription?
    10·2 answers
  • A cactus is...<br> A. a herbivore<br> B. a carnivore<br> C. a scavenger<br> D. a decomposer.
    8·2 answers
  • Stars start as… a. Cosmic rays b. Chunks of rock c. Disks of dust and gas d. Ice
    10·2 answers
  • In the microscope activity, you viewed some of the same specimens under multiple microscopes. Describe the differences in what y
    11·1 answer
  • ________ capture solar energy and use photosynthesis to produce sugars
    15·1 answer
  • Which 2 subatomic particles are located in the nucleus?
    11·2 answers
  • Need help emt science class
    6·1 answer
  • Does anyone know what this is asking :)? And give an example of what I am supposed to put? BRAINLIEST
    7·1 answer
  • HELP ASAP!! 2 MINUTES!! I'll give brainliest and points and thanks if you get it right.if you do 1 I’ll give you a thanks, if yo
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!