1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
15

Where does the energy needed to make electricity come from?

Biology
2 answers:
noname [10]3 years ago
6 0

Answer:

Where does the energy needed to make electricity come from?

<em>A, fuel.</em>

If a marshmallow is toasted over a campfire, where did the energy to ‘toast’ the marshmallow originate?

<em>C, fire.</em>

Where does almost all of Earth’s energy come from?

<em>A, The Sun.</em>

Which process is responsible for turning the Sun’s energy into the energy stored in an apple?

<em>D, Photosynthesis.</em>

Where does Earth’s internal heat come from? Choose all correct answers.

<em>B, Leftover from Earth’s formation, and C, Radioactivity.</em>

<em>Sorry if I got any incorrect, I hope this helped.</em>

Brut [27]3 years ago
4 0

Answer: Question 1 is A (Fuel) and Question 2 is A (Fire) and Question 3 is A (The Sun) and Question 4 is D

Explanation:

You might be interested in
Activities of the digestive system generally increase when it is stimulated by
SashulF [63]

Answer:

B. Parasympathetic impulses

5 0
3 years ago
What is Clubfoot and how you get it?
mrs_skeptik [129]

Clubfoot describes a range of foot abnormalities usually present at birth (congenital) in which your baby's foot is twisted out of shape or position. In clubfoot, the tissues connecting the muscles to the bone (tendons) are shorter than usual.

7 0
3 years ago
A group of similar cells are called a _____________<br><br> (Science)
Aneli [31]

Answer:

Theeeee answerrrrrrr isssss

tissues

4 0
3 years ago
Help ⚠️ is for today
Pani-rosa [81]
I think it’s frameshift, sorry if it’s wrong though I’m not sure
7 0
3 years ago
Blue whales have 44 chromosomes in every cell. determine how many chromosomes you would expect to find in the following:Sperm ce
baherus [9]

Sperm cell: We expect to find 22 chromosomes.

The spermatozoon is a small cell (5 micrometers in diameter), much smaller than the ovum, but with a movable tail (a flagellum) 60 micrometers long. To be lightweight and mobile, to quickly reach the egg, the sperm gains space by minimizing its cytoplasm and compacting its DNA. Head is covered with the acrosome, a pocket full of enzymes that will be used to pierce the membrane of the egg.

It is a haploid cell because it contains half of the genetic material of the individual, lost at the time of meiosis during the process of spermatogenesis that the primordial germ cells undergo in the seminiferous tubules of the testes.


Egg Cell: We expect to find 22 chromosomes.

The egg is the sexual cell (or gamete) produced by the females of the animals.

Like all gametes, the egg is haploid, it contains half of the chromosomes of the future embryo, so the number of chromosomes will be 22 instead of 44. Then this egg will meet a sperm cell to gather their chromosome and form an embryo of 44 chromosomes.


Daughter Cell from Mitosis: We expect to find 44 chromosomes.

Mitosis, which ensures the birth of cells identical to the mother cell during asexual multiplication (so the number of chromosomes will remain the same, it will not divide in two).

Mitosis is an asexual cell division. This means that it is just a division of a mother cell into two daughter cells, which will inherit exactly the same genetic inheritance.


Daughter Cell from Meiosis II: We expect to find 22 chromosomes.

Meiosis is a particular mode of division of the living cell by which an initial cell with 2n chromosomes (in this case 2n = 44 chromosomes), a diploid stage, gives rise to four daughter cells possessing only n chromosomes, a haploid stage (n = 22 chromosomes). Meiosis is one of the forms of cell reproduction, this process is performed on the gonads to produce gametes.

4 0
3 years ago
Read 2 more answers
Other questions:
  • A rabbit eats a carrot for food. What happens to the molecules of the food?
    15·1 answer
  • Which process is a form of mechanical weathering?
    5·2 answers
  • If the water temperature in a lake rises from 10%c to 25%c, what effect is it likely to have on aquatic that a high demand for d
    9·1 answer
  • High cholesterol levels can cause heart health problems, however, it also interacts with the cell membrane. If cholesterol level
    13·1 answer
  • What tool is used to determine the elements that are in a star
    14·1 answer
  • Ligands (molecules that bind) such as insulin bind to receptors in a reversible manner. what properties of noncovalent bonds len
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Explain how the theory of evolution is supported. (list and describe each evidence)
    13·2 answers
  • Webbed fingers is inherited as a recessive X-linked trait. An unaffected male has children with an affected female. What is the
    11·1 answer
  • How many CO2 molecules are produced when three glucose molecules undergo cellular respiration? Explan ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!