1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
3 years ago
13

Please please answer asap

Biology
1 answer:
Hatshy [7]3 years ago
3 0

Answer:

oxygen and glucose

your welcome i hope this helps

Explanation:

You might be interested in
What is a is a herbivore
maksim [4K]
An animal who eats only plants.
Hope this helps!
~LeviOsa
7 0
3 years ago
Read 2 more answers
A crow is an omnivore. On what level of the energy cycle would the crow be placed? *
Zanzabum

Answer:

middle :)

Explanation:

8 0
3 years ago
Read 2 more answers
Cuál de las siguientes es una función de ARNm? *
FromTheMoon [43]

Answer:

R. Crear nuevas proteínas

Explanation:

Hope it helps :)

4 0
3 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
The information specifying the traits of an organism is present in units of chemical substances in the center of a DNA molecule.
DIA [1.3K]

Answer:

Nitrogenous base

Explanation:

Adenine, thymine, guanine, cytosine

3 0
4 years ago
Other questions:
  • "_____ is an unpleasant side effect that alcohol withdrawal creates for an alcoholic."
    12·2 answers
  • State one way a complete blockage at location X would affect the reproductive process ? Please answer !!
    12·1 answer
  • Klinefelter syndrome is an consequence of what type of mutation?
    9·2 answers
  • Why do some cells look so different than other cells?
    15·1 answer
  • One result of air pollution is ____________________, which is precipitation that contains more acid than normal
    5·2 answers
  • If the hypothesis tracing the extinction of the dinosaurs to an impact is correct, the dinosaurs died off largely because ______
    5·1 answer
  • Which theory suggests that the moon and the earth formed at the same time from dust from the solar nebula that formed the Sun?
    14·2 answers
  • What is a possible genotype for a person with O blood?
    10·1 answer
  • g Sickle-cell anemia arises from a mutation in the gene for the beta chain of human hemoglobin. The change from a GAG to a GTG i
    10·1 answer
  • Assignment: The West Nile Virus Exploration
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!