Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
- Provide the family with lead education
- Consider treating the child with appropriate chelation therapy
- Refer the child to a clinical center specializing in lead poisoning
If the blood lead level<span> of a preschooler is found to be between 20 and 44 mcg/dL, the nurse should provide lead education to the family. The nurse should also consider treating the child with appropriate chelation therapy. The nurse may refer the child to a clinical center specializing in lead poisoning. The nurse should refer the child to social services if the child’s blood lead level is between 15 and 19 mcg/dL. The nurse should immediately provide diagnostic testing and initiate chelation therapy if the child’s blood lead level is 70 mcg/dL or greater.</span>
I hope this helps with your work :)
Answer:
The last choice.
Explanation:
The molecules would be stored for later use. The cells won't just throw out as molecule they could use later, they will n. it until they need it again.
Answer:
The answer is The pressure of gas in your lungs is inversely proportional to the volume in your lungs.
Explanation:
Because Boyle's law describes how air moves in and out of your lungs during inspiration and expiration. By the changing the volume inside the thoracic cavity, the pressure changes in the lungs. Increasing volume of thoracic cavity leads to a decreased pressure, causing air to flow into the lungs, down its pressure gradient and thus causing inspiration.