1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
13

A young child develops type 1A diabetes. The parents ask, They tell us this is genetic. Does that mean our other children will g

et diabetes? The best response by the health care provider would be:
A) Probably not since genetically your other children have a different cellular makeup, they just might not become diabetic.
B) If you put all your children on a low-carbohydrate diet, maybe they won't get diabetes.
C) We don't know what causes diabetes, so we will just have to wait and see.
D) This autoimmune disorder causes destruction of the beta cells, placing your children at high risk of developing
Biology
1 answer:
fomenos3 years ago
5 0

Answer:

D) This autoimmune disorder causes destruction of the beta cells, placing your children at high risk of developing

Explanation:

Type 1A diabetes is an autoimmune disease in which our immune cell attacks the beta cell of the pancreas which is responsible for producing insulin. So due to low beta-cell, insulin is produced in very less amount which cause diabetes.

This diabetes type can be transferred from parents to children. The chances of disease increase when both parents have type 1A diabetes. Therefore this autoimmune disorder cause beta-cell destruction, placing your child at high risk of developing would be the best response by the health care provider.

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which actions should a nurse take while caring for a preschooler whose blood lead level is found to be 25 mcg/dl? select all tha
netineya [11]
- Provide the family with lead education
- Consider treating the child with appropriate chelation therapy
- Refer the child to a clinical center specializing in lead poisoning

If the blood lead level<span> of a preschooler is found to be between 20 and 44 mcg/dL, the nurse should provide lead education to the family. The nurse should also consider treating the child with appropriate chelation therapy. The nurse may refer the child to a clinical center specializing in lead poisoning. The nurse should refer the child to social services if the child’s blood lead level is between 15 and 19 mcg/dL. The nurse should immediately provide diagnostic testing and initiate chelation therapy if the child’s blood lead level is 70 mcg/dL or greater.</span>
8 0
3 years ago
The cerebrum exhibits folds called gyri separated by grooves called sulci.
LekaFEV [45]
I hope this helps with your work :)

7 0
2 years ago
Cells can make certain molecules when needed for a certain function. What happens when those molecules are no longer needed
Elan Coil [88]

Answer:

The last choice.

Explanation:

The molecules would be stored for later use. The cells won't just throw out as molecule they could use later, they will n. it until they need it again.

4 0
3 years ago
Which of the following descriptions accurately describes Boyle’s law?View Available Hint(s)Which of the following descriptions a
N76 [4]

Answer:

The answer is The pressure of gas in your lungs is inversely proportional to the volume in your lungs.

Explanation:

Because Boyle's law describes how air moves in and out of your lungs during inspiration and expiration. By the changing the volume inside the thoracic cavity, the pressure changes in the lungs. Increasing volume of thoracic cavity leads to a decreased pressure, causing air to flow into the lungs, down its pressure gradient  and thus causing inspiration.

8 0
3 years ago
Other questions:
  • A company in San Francisco uses petroleum products to make plastics. Arrange the sentences in the correct order to show how the
    6·2 answers
  • What is an electron orbit (energy level) ?
    15·1 answer
  • What do scientist do if there hoptestisis is wrong?
    13·1 answer
  • What happens to E. coli when lactose is not present?
    13·2 answers
  • What are the steps in filament theory
    15·1 answer
  • #4) Why is DNA in the mitochondrial DNA known as "Eve's DNA"? *
    7·1 answer
  • If the experiment shows the original hypothesis is false, the scientist
    11·1 answer
  • Please help ASAP 65 POINTS IF YOU GET IT RIGHT!!!
    11·2 answers
  • Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in
    13·1 answer
  • Which of the following is NOT part of s3xual reproduction?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!