1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
2 years ago
12

Which of the following best describes a benefit of one type of nonrenewable energy?

Biology
1 answer:
STALIN [3.7K]2 years ago
3 0

Answer:

" Natural gas does not produce greenhouse gases as other energy sources do."

Explanation:

The answer, "Coal deposits are found on nearly every continent and mining coal poses few risks." shows only how it can be a better option, but does not show how it can benefit.

The answer, "Petroleum is relatively inexpensive compared to other forms of energy." only shows how it can be a better option, but does not show how it can benefit.

The answer, "Nuclear power increases water vapor in the atmosphere." does not clearly state how this benefits us.

<em>-kiniwih426</em>

You might be interested in
Organisms belonging to the same _____ would be the most closely related.
madreJ [45]
I think that the answer is family
6 0
3 years ago
IQ tests are said to have "reifled" intelligence; this means that IQ tests
Stolb23 [73]

Answer:

a. are a valid way to measure a person's inborn intelligence

Explanation:

IQ testing is an important tool for measuring an individual's innate intellectual abilities, as long as its content is not limited to just one area of knowledge. Cognitive ability is related to hereditary and cultural characteristics that can be inherited or developed throughout life. Over the years, experts have developed techniques for measuring individual intellect.

The tool is used to obtain an intelligence indicator for different purposes. Following the original idea of the test, its application may be necessary to identify children with attention deficit or who are in a more advanced learning process than other students.

The IQ test is also used to diagnose issues related to an individual's behavior and conduct, and to support a job selection process.

8 0
3 years ago
How many combinations of genotypes are possible for the coat coloration of rabbits which is governed by three alleles?
Dmitriy789 [7]

Answer:

b) 6

Explanation:

There are three different alleles (A,B,C) which are responsible for coat coloration but only combination of two can move forward because there are two loci at every homologous pair of chromosomes.

Thus, six combinations can be formed as AA, AB, AC, BB, BC, CC.

7 0
2 years ago
What is genetic resistance
Zolol [24]

Answer:

Genetic resistance (or genetic tolerance) refers to the ability of certain organisms to endure environmental conditions that are extremely stressful or lethal to non-adapted individuals of the same species

Explanation:

8 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • which term describes a type of trait that is usually expressed only when an organism has two identical alleles for the trait
    8·2 answers
  • The gender effects of congenital adrenal hyperplasia (cah) on girls have found ________.
    9·2 answers
  • The three reactants needed for<br> photosynthesis are<br> and
    13·1 answer
  • What is different between gas giants and terrestrial planets in our solar system
    6·1 answer
  • Which clade is composed of eukaryotes which are multicellular and heterotrophs?
    11·1 answer
  • A short mRNA sequence is shown in the box below. Determine the DNA sequence from which this mRNA sequence was transcribed.
    11·2 answers
  • Which gland of the endocrine system is located near the stomach and is responsible for producing enzymes and hormones that help
    5·2 answers
  • ___is the main energy source for all life on earth
    15·2 answers
  • If there are 7.6 billion people, why can't I get a gorlfriend?<br>​
    9·2 answers
  • HELP ASAP! ILL GIVE BRAILIEST TO THE 1ST ANSWER! NO SPAM!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!