Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer:
the independent variable is the Mosquito repellent on the arms The dependent is the amount of mosquito
Adding a negative catalyst I’m sure
<span>The substance that aids in the transport of glucose from outside of the cell to inside of the cell are the protein. The answer is letter C. There is a thing called channel protein that allows the transport of specific substance across the cell membrane. </span>
The standard unit of radiation related to biological hazards is known as the Roentgen.
