1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
2 years ago
8

18. What are the five muscles that form a box to control the wrist?

Biology
1 answer:
il63 [147K]2 years ago
3 0

en las imagenes te digo

You might be interested in
How long do chickens live?
Bond [772]
8-10 years but one has lived to 20 years.
7 0
3 years ago
Read 2 more answers
Initial first aid rendered at the scene of a fire includes preventing further injury through heat exposure. which intervention c
Volgvan
Applying ice to a fire victim leads to tissue hypoxia and necrosis because it will change the skin's temperature too fast and may cause frostbite.  The burn could have had removed a layer of skin, leaving the fragile tissue exposed which will be more sensitive to the ice.
8 0
3 years ago
A woman with type A blood (whose father was type O) has children with a man that has type O blood. Both individuals are heterozy
Fantom [35]

Answer:

Explanation:

A woman with type A blood (whose father was type O) meaning her genotype is AO mates with

Man that has type O blood (OO genotype)

Both are heterozygous for MN blood group and both also heterozygous for the FUT1 gene controlling the synthesis of the H substance (Hh)- which determines the expression of the A and B antigen.

Cross

A O M N H h

O AO OO M MM MN H HH Hh

O AO OO N MN NN h Hh hh

Type A- 1/2 O-1/2 type M- 1/4 MN-1/2 N- 1/4, type H- 3/4 h-1/4

Type A with M antigen:

1/2*1/4*3/4 = 3/32

Type A with M and N antigens:

1/2*1/2*3/4 = 3/16

Type A with N antigen:

1/2*1/4*3/4 = 3/32

Type O with M antigen:

1/2*1/4*3/4= 3/32

Type O with M and N antigens:

1/2*1/2*3/4 = 3/16

Type O with N antigen:

1/2*1/4*3/4 = 3/32.

The 3/4 value comes from the expression of Hh-3/4 (this determines if the A and B Angie will be expressed).

8 0
3 years ago
What would be a good shelter to build for tropical rain-forest biome
goldenfox [79]
 <span>Plants, animals, and humans all need </span>shelter<span> to survive. Plants in ... When an area has many different species living in the same habitat, it has a </span>great<span> deal of biodiversity. ... Just about every other plant on earth </span>would<span> wilt and die if it were exposed to the ... The ground of the </span>rainforest<span> is called the </span>forest<span> floor.</span>
7 0
3 years ago
What molecule makes the trunk of a tree sturdy
kirill115 [55]

Answer:

Cellulose

Explanation:

trunk is the main axis of a tree that supports the branches and is supported by roots. Cellulose makes it sturdy. Cellulose is the main substance in the walls of plant cells, helping them to remain stiff and upright.

3 0
3 years ago
Other questions:
  • The molecule on which an enzyme acts is called the product. <br> truth or false
    6·1 answer
  • What statement about enzymes and pH is true?
    10·2 answers
  • What characteristic of earth results in different season over a period of a year
    5·2 answers
  • When blood glucose levels decrease, in between meals, during fasting or from starvation, increased levels of ________ help to in
    12·1 answer
  • How do natural disasters impact human life?
    11·2 answers
  • What body system produces movement
    13·1 answer
  • In photosynthesis, energy from the sun is converted to (and stored in) which of the
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What impact do you think 3d printing could have on the future of science?​
    10·2 answers
  • As a result of your Zombie Apocalypse, the grass at a local park will no longer be mowed. What type of succession is this (prima
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!