1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
2 years ago
13

Describe how plant cells keep themselves rigid. Word Count: of 125

Biology
1 answer:
Sveta_85 [38]2 years ago
4 0

Las paredes externas de una casa o un automóvil brindan una barrera fuerte e inflexible que protege a sus habitantes humanos de un mundo externo rudo e impredecible. Podría esperarse que el límite externo de una célula viva estuviera construido de una barrera igual de fuerte e impenetrable porque también debe proteger su delicado contenido interno ante un ambiente no vivo y a menudo inhospitalario. Sin embargo, las células están separadas del mundo externo por una estructura delgada y frágil llamada membrana plasmática que sólo mide 5 a 10 nm de espesor. Se requerirían casi 5 000 membranas plasmáticas apiladas una sobre otra para igualar el grosor de una sola página de este libro.

You might be interested in
How do octopi and fish differ?
sleet_krkn [62]
C. octopi are invertebrates and fish are vertebrates.
4 0
3 years ago
Can nucleic acids diffuse through membrane
Arlecino [84]
Yes it can !!!!!!!!!!!!!!! just did that got it right
4 0
3 years ago
Which variables make a volcano such as Popocatépetl more “dangerous” than others?
Kaylis [27]

Answer:

I think it's B not sure though check in Google or read the book

6 0
3 years ago
Read 2 more answers
Which is an example of condensation
slava [35]

Answer:

rain

Explanation:

8 0
3 years ago
Can you explain why
kobusy [5.1K]

Answer:

Air that is warmer is able to evaporate more water into the atmosphere. An air mass with more water vapor available to precipitate will naturally create more precipitation.

Explanation:

Most of South Florida has a tropical climate. There is a defined rainy season from May through October, when air mass thundershowers that build in the heat of the day drop heavy but brief summer rainfall. In some years the dry season becomes quite severe and water restrictions are imposed to conserve water.

8 0
3 years ago
Read 2 more answers
Other questions:
  • How does changing and organism's habitat affect the number and variety of organisms present?
    11·1 answer
  • If women with type o blood and a man with type ab blood have children, what are the childrens possible jeans
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain how antibiotic resistance in bacteria provides evidence that supports Darwin’s theory of evolution
    7·2 answers
  • Which statement best describes the function of ATP synthase?ATP synthase pumps protons back into the mitochondrial matrix.ATP sy
    7·1 answer
  • I need help please help me
    12·1 answer
  • Why did mendel study pea plants ?
    11·2 answers
  • Helppppppppppppppppppp I’ll mark you brainlist
    14·2 answers
  • A group of scientists have created a new drug X that helps with anxiety.What is your hypothesis?
    5·1 answer
  • Helpppppppppppppp my friend needs it
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!