Answer:
Fructose- Monosaccharide
Lactose- Disaccharide
Sucrose- Disaccharide
Maltose- Disaccharide
Glucose- Monosaccharides
Explanation:
Monosaccharides are the simplest sugar which is made up of only one unit of sugar and can not be hydrolyzed into smaller form because it is the smallest form of sugar. These monosaccharides are basic units for disaccharides and polysaccharides. For example glucose and fructose.
Disaccharides are made up by the joining of two monosaccharides. For example, lactose which is made up of glucose and galactose, sucrose made from glucose and fructose, and maltose which is made up of two glucose unit.
The ribosomes are probably what you are looking for. Hope this helps :)
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer: A, Kingdom.
Explanation: The classification of living things has seven levels that become more specific as they go down.
Kingdom>Phylum>Class>Order>Family>Genus>Species
As you can see, Kingdoms are the largest and least specific, which means that they contain the most organisms. A way to remember the levels is by using the mnemonic "King Philip Came Over From Great Spain."