Answer:
its a compound
Explanation:
because it was broken down into a gas and blue powder, elements cant be broken into simpler substances.
ANSWER: 8.9
Nxjsksgehwndgsnsbdghsbsbdxhsjnsbsjs
The three nucleotides are the bases used to encode an amino acid of codon.
<u>EXPLANATION: </u>
Genetic code explains the bases and flow in DNA followed by the flow of amino acids present in the proteins.Proteins are usually made of 20 amino acids that has been encoded by four bases. Now, at least three bases are required to encode 20 amino acids.
Three adjacent nucleotides forms a unit called codon. Also, experiments have been done to show that the single amino acid encoded by a group of three bases. This code doesn't overlap with others and the order of flow is read sequentially without any punctuation.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
Chemical Fertilizers
C. Algal blooms followed by eutrophication is the correct one
Stockyard Runoff
Correct D. Increased biological oxygen demand/decreased dissolved oxygen
Soil disturbance
Correct A. Erosion, flooding; clogged shipping channels and harbors
Pesticides
Correct B. Reproductive failure, poisoning, and/or death (pollinators, pets, livestock, predators, children)
Explanation:
For industrial agriculture to be effective and productive today, we have to take into account many factors so our practices function in a good way. When it comes to chemical fertilizers, it is NOT a risk the Increased biological oxygen demand/decreased dissolved oxygen
, the correct risk is algal blooms followed by eutrophication. Regarding Stockyard Runoff it is wrong to think the algal blooms followed by eutrophication as risk, the actual risk is the increased biological oxygen demand/decreased dissolved oxygen. The risk in soil disturbance
is the erosion, flooding; clogged shipping channels and harbors and thinking about pesticides
, they are in risk for reproductive failure, poisoning, and/or death (pollinators, pets, livestock, predators, children)
.
