Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Enzyme Activity- Responsible reactions Enzyme catalyze nearby substrates
Cell to Cell Recognition- Recognize molecules on surface of the other cells
Cell Signalling- A chemical messenger that binds a membrane protein causing to change shape and relay the message inside a cell.
Transport materials- Provides channels for a certain solutes to pass through membrane
Answer: False.
Meat is a good source of protein. There are nine essential amino acids which are required under special conditions like illness.
These are- Histidine, Leucine, Isoleucine, Valine, Threonine, Methionine, Lysine, Phenylalanine and Tryptophan. They cannot be synthesized by the body and therefore need to be taken from external protein sources.
Since meat contains all the essential amino acids, therefore it is considered as a good source of protein. Hence, the given statement is false.
Answer:
En resultados
Explanation:
El experimento se basa en analizar el movimiento de la planta en respuesta a la luz solar, desde distintas posiciones:
- planta parada
- planta semiacostada
- planta acostada
Durante su experimento, Pedro debe ir registrando los movimientos que observa en las distintas plantas a medida que recibe la luz del sol. El registro de dichos movimientos ante el estímulo forma parte de los resultados.
- Objetivo o propósito del trabajo: analizar la influencia de la luz solar como estimulo para generar un movimiento en plantas desde distintas posiciones.
- Procedimiento: Ubicación de plantas en distintas posiciones y bajo las mismas condiciones ambientales. Exposición de todas las plantas a la misma cantidad de radiación solar. Observación del movimiento durante un periodo de tiempo determinado.
- Resultados: Registro del movimiento de cada planta en cada posición durante el periodo de tiempo que fueron expuestas a radiación. En esta instancia de vuelca en tablas o gráficos, o se describe qué fué lo que se observó durante el experimento. Cuál fue la respuesta de cada una de las plantas.
- Conclusión: Relación entre lo esperado y lo observado. Comparación con otros trabajos similares.
