1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
8

_____ acts on proteins to produce peptides which are later broken down into _____ in the small intestine

Biology
1 answer:
boyakko [2]3 years ago
3 0
The enzyme pepsin acts on proteins to produce peptides which are later broken into amino acids in the small intestine
You might be interested in
Which of the following changes between trophic levels would have the highest energy conversion efficiency?
swat32

Answer:

i believe its b

Explanation:

7 0
4 years ago
Read 2 more answers
In north carolina, demand for fresh water has increased dramatically. one of the main reasons for this is increased water use fo
Oksanka [162]

Agricultural practices relating to irrigation have the tendency to reduce the water level of river basins.

<h3>What are the effects of irrigation agriculture on river basins?</h3>

Irrigation agriculture requires that crops are watered artificially and this requires a water source. Hence, waters in river basins suffer and this leads to a reduction in their levels.

Water quality is impacted by agricultural practices such as the use of agrochemicals and fertilizers. Agrochemicals are washed into water bodies and this impacts biodiversity life in water.

One conservation strategy to reduce the impact of this kind of agricultural practice would be to practice organic farming. A farming practice that is devoid of using agrochemicals or the ones that are not poisonous to biodiversity and are biodegradable.

More on the effects of agrochemicals on waters can be found here: brainly.com/question/16259315

#SPJ1

4 0
2 years ago
A client was seen in the clinic for musculoskeletal pain, fatigue, mood disorders, and sleep disturbances. the physician has dia
KIM [24]

Fibromyalgia is widespread chronic pain, the nurse should be encouraging the client to eat a healthy diet, avoiding caffeine and alcohol, regular exercise, and stress reduction are part of the teaching plan. Application of ice is not part of the treatment regimen.

 

<span> </span>

4 0
3 years ago
A month-long study of plant growth was conducted. Three groups of plants were grown in various amounts of light: Group A receive
fomenos

Assuming the graph that shows plant groups B and C have a lower growth rate than group A, this shows that every plants needs a certian amount of sunlight to grow. Since they get their energy from the sun, it is the most crucial to a plants survival. If plants dont get the energy they need to live, as producers, primary consumers dont get get energy from producers. If primary consumer cant get energy, neither can secondary consumer and so forth.

5 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What statements are correct containing human dna?
    6·1 answer
  • When two different species of lovebirds makes babies, the offspring are unable to build a nest after they mature. the hybrid off
    11·1 answer
  • describe the interaction between the Farmer and Manufacturing objects, such as farming equipment. How does energy flow
    11·1 answer
  • Which pairings match protozoa with the structures they use to move? amoeba: flagellum; euglena: cilia; paramecium: pseudopod amo
    13·1 answer
  • What is true about elements and compounds? A. Elements contain two or more compounds. B. Compounds contain two or more elements.
    9·1 answer
  • Describes a solution in which extracellular fluid has higher osmolarity than the fluid inside the cell
    14·1 answer
  • Hermione's possible genotypes are MMss or MM'ss. What are possible genotypes of Hermione's parents who are muggles?
    15·1 answer
  • Some sea anemones can produce large colonies by reproducing asexually, but they can also produce planktonic larvae by reproducin
    10·1 answer
  • Stomata _____. exchange oxygen and carbon dioxide with the atmosphere make the chlorophyll needed for photosynthesis store extra
    10·2 answers
  • Why does snakes and frog goes for winter sleep?plz help me fßi need it's and know​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!