1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
13

An increase in the greenhouse effect causes an increase in___

Biology
1 answer:
andriy [413]3 years ago
6 0

The answer is option B "temperature." Greenhouse effect is the process of trapping the suns heat in the lower atmosphere. A increase of greenhouse effect would cause surface temperatures to rise.  Which then contributes to global warming because of melting the ice bergs in cooler areas on Earth and causing waters to rise and creating storms. It's not option A because the sun gives off heat or harmful radiant waves which doesn't increase carbon dioxide levels. Wouldn't be option D because it would contribute but it wouldn't happen without a increase of temperature. It also wouldn't be option C because oxygen isn't relevant in this case.

Hope this helps.

You might be interested in
What does scientific theory means
irina1246 [14]

Answer:

The scientific theory is a well-tested, broad explanation of a natural phenomenon that we use in everyday life

Explanation:

8 0
2 years ago
Read 2 more answers
Use of which of the following does not contribute carbon dioxide to the environment
Liono4ka [1.6K]
Choices 1, 2, and 3 all emit carbon dioxide, not enough to destroy the planet, but they still can cause it over a large amount of time, due to Carbon Dioxide being a greenhouse gas. Therefore, the answer is 4. Bicycles do NOT emit any carbon dioxide at all.
3 0
4 years ago
Heredity refers to the __________.
amm1812
I think the answer would be D since the definition of heredity is <span>the passing on characteristics genetically from one generation to another.</span>
4 0
3 years ago
Read 2 more answers
The DNA found in the nucleus is responsible for directing the
Lunna [17]
The Correct answer is B
3 0
3 years ago
What type of candy is earths mantle most like?
professor190 [17]

Answer:

Ice cream , peanut butter or melted marshmallows with puffed rice- cereal

Explanation:

can all work for the mantle layer of your project. Push a hard candy representing both the inner core and outer core into a ball of ice cream, or spoon a layer of ice cream into a clear plastic cup over the top of the inner and outer core.

Hope it helps

5 0
2 years ago
Other questions:
  • Which weather condition most directly determines wind speeds at Earth's surface?
    7·1 answer
  • Which condition is characterized by the destruction of the walls of the alveoli?
    8·1 answer
  • The feelings or sensations a work of art produces are called
    9·1 answer
  • If a speaker begins by saying, "It is nature’s best bug control, and night-blooming flowers depend on it for pollination. As Nor
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • (10 points) Marine Biology.
    5·1 answer
  • Tom grew three inches in one year. Which organ system was directly responsible for his growth spurt?
    8·2 answers
  • Why is sunlight important for life on earth
    11·1 answer
  • True or False? Endurance training results in an increase in parasympathetic nervous activity and this allows for a reduced resti
    13·1 answer
  • What is the mass number of an ion with 104 electrons, 158 neutrons, and a +1 charge?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!