1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudiy27
2 years ago
11

How do mountains and large bodies of water affect the biomes of tundra and grassland?

Biology
1 answer:
Rasek [7]2 years ago
6 0

Answer: Mountains can trap moisture on one side, leading to an increase in precipitation in this area but lower amounts of precipitation on the opposite of the mountain.  Thus, altitude is going to affect both temperature and precipitation which will affect the composition of biome.

Land masses near large bodies of water, especially oceans, change temperature as the oceans change temperature: slower and with less extreme fluctuations than land masses farther away. Ocean currents like the Gulf Stream carry heat from the tropics, affecting the climate of areas away from the tropics.

Explanation:

You might be interested in
28
Reptile [31]

Answer: Option D, all of the above

Explanation:

Changes to the global climate includes changes to temperature, changes to pressure

and changes to precipitation.

4 0
3 years ago
Which of the following tools should a scientist use to measure an object in meters.
Mekhanik [1.2K]

Answer:

C. Tape Measure

Explanation:

Thats the best of the options.

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What evidence would indicate whether this animal is aquatic or terrestrial in mollusca?
zhenek [66]
<span>When there is the presence of gills it will be easy to determine if the animal is aquatic or mollusk.

Aquatic means related to water. While Mollusca is termed as the large phylum of invertebrate animals whose members are called mollusks. Most of the mollusks live in water.

The most numerous mollusks are mantle which is important for cavity and is used for excretion and breathing, the presence of radula and their structure of the nervous system.</span>
7 0
3 years ago
Read 2 more answers
What form a spindle shaped structure of protein fibres on which the chromosomes move during nuclear division? 
frez [133]
Function of centrioles

An organelle that forms a spindle-shaped structure of protein fibers on which the chromosomes move during nuclear division are called the centrioles. Centrioles are part of the animal cell organelles. Hence, they are a small part of the microtubules organized and set in a particular course. Microtubules include 9 sets. Centrioles contain a cylindrical structure, packed with protein which is described as tubulin. Found mostly in eukaryotic cells beside the nucleus.



5 0
3 years ago
Other questions:
  • The gas that makes up the majority of our atmosphere is
    12·2 answers
  • _____ is the capability of two or more items or components of equipment or material to exist or function in the same system or e
    12·1 answer
  • A doctor is examining a gland under a microscope. It has a duct. What type of gland is it?
    6·1 answer
  • On a recent field trip, you discover a new species of plant. Since you are interested in plant reproduction, you rear the plant
    7·1 answer
  • During the day, plants use the carbon dioxide they produce for
    5·1 answer
  • Arrange the symbols to form a DNA molecule.
    15·1 answer
  • Disturbances in memory, consciousness, or identity are symptoms of:
    12·2 answers
  • What would the complimentary RNA strand be if one of the strand's base sequence was:
    8·2 answers
  • Inside cells, special molecules carry messages from the membrane to the nucleus. Which body system uses a similar process?
    10·2 answers
  • The mixing of fats with water, assisted by molecules that have both nonpolar and polar ends, is called
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!