During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Too much logging in the oyamel fir forests could lead to the eastern monarch butterfly going extinct because <u>the entire population of the species spends winter in oyamel fir forests.</u>
<u>Why it is the correct option:</u>
a. The oyamel fir forests serve as the winter home for the eastern monarch butterflies. The entire population of monarch butterflies moves to oyamel fir forests in Mexico during winters to protect themselves from the freezing cold temperatures of their natural, breeding habitat. So, too much logging of the oyamel fir trees will destroy the winter habitat of these butterflies, and hence will lead to the decline in their population.
<u>Why the other options are incorrect:</u>
b. the butterflies breed in the oyamel fir trees is an incorrect option because the monarch butterflies breed in their natural habitats in the US.
c. the winters are too cold in oyamel is an incorrect option because these butterflies move to oyamel forests to protect themselves from cold.
d. the butterflies feed on the oyamel fir trees is an incorrect option because the monarch butterflies feed on milkweed.
Know more about monarch butterflies
brainly.com/question/3414355
#SPJ4
Position and mass product
They will be genetically identical to the daughter cells.
The correct answer is Mitosis !! B !!
Mitosis did not do DNA varriations !!
