1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
2 years ago
15

More than 90% of measles infections occurs in children under ____ years old.

Biology
1 answer:
Lesechka [4]2 years ago
6 0

Answer: More than 90% of measles infections occurs in children under 15 years old.

Hope this helps

You might be interested in
Photosynthetic and chemosynthetic organisms can be called primary producers because they make their own food?
LenaWriter [7]

Heterotrophs are organisms that must consume food from other organisms because they are unable to synthesize their own food molecules.

<h3>What is heterotrophs?</h3>
  • An organism is referred to be a heterotroph if it is unable to manufacture food on its own and must obtain it from other sources of organic carbon, primarily plant or animal materials.
  • Heterotrophs are primary, secondary, and tertiary consumers in the food chain but not producers.
  • Because they eat producers or other consumers, heterotrophs are referred to as consumers.
  • Humans, dogs, and birds are all instances of heterotrophs.
  • In a food chain, a group of creatures that supply energy and nutrients to other organisms, heterotrophs occupy the second and third levels.
  • An organism is referred to as a heterotroph if it consumes other plants or animals for food and energy.
  • Its origins are in the Greek words hetero, which means "other," and trophe, which means "nutrition."
  • Autotrophs and heterotrophs are two main classifications of organisms depending on how they receive energy and nutrients.

Learn more about heterotrophs here:

brainly.com/question/21450466

#SPJ4

3 0
10 months ago
In addition to their role as building blocks for proteins, amino acids are used as precursors for the biosynthesis of a wide var
drek231 [11]

Answer:

Amino acids are the building blocks or monomers of proteins. These are the molecules that act as the precursors for the biosynthesis of various hormones some other molecules of our body. these amino acid molecules for by the process of protein synthesis.

The given amino acids are precursors of the following molecules-

1. Histamine - Histidine

2. Epinephrine - Tyrosine

3. Serotonin - Tryptophan

4. Glutathione - Cysteine, Glutamate and Glycine

5. Heme - Glycine

6. NAD(H) - Tryptophan

7 0
3 years ago
Are all cattle breeds the same species?
stepan [7]
No just like dogs they differ in some ways

Giddy UP
6 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Describe Crick's Central Dogma. Explain why this is an inference.
Nataly [62]
The Central Dogma states that first DNA is replicated into RNA and then the RNA leaves the nucleus and becomes Amino Acids. It is an inference because it cannot be observed, and it's only a prediction of what would happen, but it is the most likely inference
6 0
2 years ago
Other questions:
  • Which of the following correctly explains differences between steroids and enzymes
    9·1 answer
  • The sequence of the bacterial DNA is ATGGGCTAGTCTT. What will the complementary strand be?
    8·1 answer
  • A population of bacteria is treated with an antibiotic. Because of variation in the population of bacteria, what is a possible o
    13·2 answers
  • When two atoms transfer electrons, the bond formed is called a/an _______ bond.
    8·1 answer
  • Which of the following choices is not a function of the Golgi apparatus?
    13·1 answer
  • What does producer mean
    5·1 answer
  • Why is it that the typical diploid chromosome number of many
    14·1 answer
  • What is the solid obtained at the neck of a funnel in sublimation?
    7·1 answer
  • Compare photosynthesis in bacterial and cyanobacteria​
    7·2 answers
  • The tough, fibrous, outermost covering of the spinal cord is the.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!