1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
15

After learning in physical anthropology class that a cleft chin is recessive and that dimples, a free-hanging earlobe, and tongu

e rolling are dominant, your friend tells you over dinner that she is certain she is adopted. What could have caused her to arrive at this conclusion?
Biology
1 answer:
kiruha [24]3 years ago
7 0

Answer:

Based on both of her parents have cleft chins and she does not have it.

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
The frequency of the red eyes (p allele) in fruit flies is 63% what is the frequency of the white eye allele (q allele)?
Alenkinab [10]
That would be about 25%
4 0
2 years ago
Read 2 more answers
Which conservation effort helps to conserve trees?
garri49 [273]
I'd think it's probably the recycling of newspapers, as trees are making of paper can be a reason for deforestation. With recycling of newspapers, fewer trees need to be cut down.
8 0
3 years ago
Read 2 more answers
Need help with question 6a and 6b
prohojiy [21]
Discontinuous variable ;)
7 0
3 years ago
Which of the following foods is most nutrient dense for protein:
Kay [80]
Product A with 300 calories and 19 grams of protein
7 0
2 years ago
Other questions:
  • If heat energy is transferred from direct contact between a warm object and a cold object, it has been transferred by _____.
    11·1 answer
  • Two larger molecules made from simple sugar
    10·1 answer
  • Phosphorus is never found in the atmosphere?
    9·2 answers
  • What household items (other than a battery) represents mitochondria?
    7·1 answer
  • Why is carbon unique to other elements
    8·2 answers
  • Why do cells need glucose?
    7·2 answers
  • Explain why the frequency of the tusklessness trait is increasing in the African elephant population. Justify your answer using
    14·1 answer
  • Mention at least three species of HPV(Human papinovirus)
    7·1 answer
  • En que conciste la funcion de relacion?
    15·1 answer
  • Please help meeee ! ​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!