1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hitman42 [59]
3 years ago
10

No stripe on the head (H) is dominant, a black stripe on the head is recessive. If dad's genotype is Hh, what are the odds that

the offspring will have a stripe?
Select one:
a. 50%
b. 100%
c. 0%
d. 25%

Biology
1 answer:
olga55 [171]3 years ago
7 0

The chance of the offsprings with stripe on head is 50%.

Option A.

<h3><u>Explanation:</u></h3>

Here according to the figures, the male is the brown one which has no stripe on his head as mentioned, and the female is the pink one who has a stripe on her head. The gene for the head stripe is denoted by H.

So the genotype of the father which is given as Hh. He is heterozygous.

The genotype of the mother should be hh as she has stripe and she must be homozygous recessive to have it.

So the gametes from father is H and h. Whereas the gametes from mother is only h.

So the genotype of the offsprings are Hh and hh as 50% each.

So the probability of the offspring being striped head is 50%.

You might be interested in
Photosynthesis allows organisms to harvest the Sun's emergy to produce<br> _______
jekas [21]

Answer:

energy

Explanation:

7 0
3 years ago
Read 2 more answers
What is a condition in which the neuron membrane is more positive on the outside?
Elan Coil [88]
Resting potential is when the outside is more positive, while the inside of the membrane is approximately -70mv
4 0
3 years ago
Why will the world never run out of carbon?
jekas [21]
Because we have carbon in the ground in the air and every were else
3 0
3 years ago
Complex molecules are formed by the bond formation between monomers . Which process is being referred to in this statement ?
snow_tiger [21]
The answer is B as many monomers combine together, breaking their carbon carbon double bonds to form one large polymer.
3 0
3 years ago
Read 2 more answers
You're on the pilot episode of a new game show called "The Transport Factor." The host hands you three different amino acids, fo
sp2606 [1]

Answer:

Nine

Explanation:

These are called carrier proteins, and they have what it is called: solute-binding sites, that when saturated, they are considered "full".

Each different amino acid needs a separate carrier protein to move it across the plasma membrane, so that's 3, then the four different sugars need separate carriers as well, we add 4 more then, we have 7 so far, finally the 2 different ions use 2 more, plus the other 7, totals 9.

5 0
3 years ago
Other questions:
  • Complete a cross between two organisms that are both heterozygous for Black fur (Bb which is dominant over white fur). Use a Pun
    12·1 answer
  • is it possible to predict possible gene combinations in offspring from the genes of their parents? explain
    13·1 answer
  • What would happen if the fatty acids in cell membrane were polar molecules
    12·1 answer
  • Enzyme molecules normally interact with substrate molecules. Some medicines work by blocking enzyme activity in pathogens. These
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • You have a 15kb plasmid. EcoRI cuts the plasmid into 7kb and 8kb pieces, and BamHI cuts the plasmid into 1kb and 14kb pieces. If
    7·1 answer
  • Someone please help me , my work is due tomorrow. How does a Volcano effect the availability of natural resources? ( including f
    10·2 answers
  • Which of the following are characteristics of
    8·2 answers
  • Organisms that cannot produce their own food and rely on other organisms for nourishment are
    13·1 answer
  • How can the efficiency of a system impact the environment, economy and society
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!