1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
3 years ago
6

Thinking of your own energy use, list some ways you use energy every day. Are there ways you could reduce your energy use?

Biology
1 answer:
OLga [1]3 years ago
4 0
Use - drying hair , washing and drying clothes , using lamps , air conditioners
You could save energy by allowing hair and clothes to air dry , opening windows and turning air off on mild days , this would also help with decreased use of lamps and lighting by allowing natural light in .
You might be interested in
Plz help!!! lots of points!!!
vovikov84 [41]
Hey there budd!

Your question is stated above: <span>Which option describes what the U.S. Green Building Council has created?

Based from my information, I know for a fact the the answer would NOT be option D. The government would not </span>to simplify the certification process for sustainable building and construction because they want (high) quality people working for them, not people who have low certificates to work for the government.

I (seriously) believe that the correct answer to this question would actually be the first option. (A) Government control over all engineering design materials. So, this would show you that the U.S. Green Building Council has created a government to watch over and control everything that is being designed.

I hope this helps you!
8 0
3 years ago
Read 2 more answers
Why do organisms have to be “organized” to live?
TEA [102]

Answer:

because they have to be seperated

Explanation:

7 0
3 years ago
He portion of the membrane that faces the lumen is called the ________ membrane.
irina1246 [14]

The portion of the membrane that faces the lumen is called the apical membrane.

Membrane is the lipid bilayer that surrounds the cell on its outer surface. The membrane serves various functions like: protection, cell shape and integrity and regulate the traffic of molecules across the membrane. It is semi-permeable in nature.

Lumen is the hollow portion present inside any organ or tube like the artery or intestine. It is a Latin word that means 'an opening'. The lumen of different organs served various purposes. However, the major function is the transport of substances like air, nutrients, waste materials, immune cells, hormones, etc.

To know more about lumen, here

brainly.com/question/28116757

#SPJ4

5 0
2 years ago
. Which of these is a response of cats to external stimuli?
Step2247 [10]

Answer:

A. hairs on the back stand up when scared

Explanation:

B and C are not responses to stimuli, and D is a response to internal stimuli

7 0
3 years ago
Read 2 more answers
Which statement is true about prokaryotic cells?
Mashutka [201]

Answer:

It’s A

Explanation:

Itw a because it does contain a nucleus

3 0
3 years ago
Other questions:
  • Which of the following correctly describes the order of events occurring during a sympathetic nervous system response?
    5·2 answers
  • What's the job of the iris
    13·1 answer
  • Review the water cycle diagram below. What effect would removing the precipitation stage have on this environment?
    15·1 answer
  • Oraciones con selva
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Okay so I need the steps of photosynthesis in the right order, I'm taking a test on Mgraw Hill and it is a huge emergency. Scree
    13·1 answer
  • Which structure stores energy for the in the form of ATP?
    5·1 answer
  • In what form is the DNA found when a cell is beginning cell division or is involved in cell division?
    6·1 answer
  • Plz help/will give brainliest!​
    10·1 answer
  • What are the current populations of each organism?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!