1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
11

Scientists often use fruit flies as a method to test hypotheses about human genes. Why are fruit flies advantageous in the study

of human inheritance?
They can self-pollinate.
They lack nucleic acids.
They are very different from humans.
They reproduce quickly and take up little space.
Biology
1 answer:
Agata [3.3K]3 years ago
7 0

Answer:

D. They reproduce quickly and take up little space.

Explanation:

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Describe the parts of the synovial joint and state their functions?​
frutty [35]
SYNOVIAL joints are made up of five classes of tissues. These include bone, cartilage, SYNOVRUM, SYNOVIAL ligaments. Tendons are tough band of fibrous connective tissue that connect muscles to bones. Hope this helps x
8 0
3 years ago
Androgynous behaviors are solely the product of biological sexual differences.
xxTIMURxx [149]

Androgenous behaviors is not solely the product of biological sexual differences, such as the ability to bear children. It is also regarded as product of evolution and natural selection where an individual may be androgynous, displaying feminine and masculine characteristics or traits based on one’s gender identity and learned gender role. This can be made possible through the ongoing social interactions that individuals have with each other.

<span> </span>

5 0
4 years ago
The algae at the beginning of the food chain is a_______.
podryga [215]

Answer:

c

Explanation:

yep

4 0
3 years ago
Read 2 more answers
Received information is called a transduced signal because: _________.
Annette [7]

Answer:

The correct answer is - e. many different molecules form a signaling cascade.

Explanation:

Signal transduction is the number of events that take place inside the body of a human from the external atmosphere to transmitting a chemical or physical signal through a number of molecular events of signaling cascade.

The transmission of the particular chemical or physical signal is caused a sequence of phosphorylation events inside the cell it involves specific protein receptors and different types of molecules.

7 0
3 years ago
Other questions:
  • When a plant generates food through photosynthesis, this food
    11·1 answer
  • ???????????????????????????????????????
    11·1 answer
  • Ejemplo de una estructura homologa
    15·1 answer
  • A group of paleontologists discovered fossil remains of a new organism. They noted the following features of the organism:
    7·1 answer
  • Which is something that scientists dont help doctors do
    9·1 answer
  • What is the current in a 120V circuit if the resistance is 40?
    15·2 answers
  • Write a definition of homologous chromosomes using the terms “gene” and “allele.”
    13·1 answer
  • 10 points
    10·1 answer
  • What could explain the curve in this population growth graph? A graph has time on the horizontal axis and population size on the
    9·2 answers
  • During calcium chloride transformation of bacteria, during which step does plasmid DNA enter the bacterial cells?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!