1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AURORKA [14]
2 years ago
5

What is the different between men and women

Biology
2 answers:
creativ13 [48]2 years ago
5 0

Answer:

one has a pp and one has a coochie

DochEvi [55]2 years ago
3 0
They have different down there ifykyk
You might be interested in
Which particle has the most energy ice water steam or no difference
Shkiper50 [21]
Steam has the most energy because a particle has the most energy when it contains high internal energy. (Has the larger temperature)

I Hope This Helped!
8 0
3 years ago
Read 2 more answers
LOTS OF POINTS YOUR OPINION TYPE QUESTION
zimovet [89]
I would first,find a way on how to fix the earth.Then I would put houses on the lands.
3 0
3 years ago
What happens amino acids link <br> together
mars1129 [50]

Answer:

Within a protein, multiple amino acids are linked together by peptide bonds, thereby forming a long chain.

4 0
3 years ago
Read 2 more answers
Which of the following statements might someone use to most support a decision to buy organic produce?
IrinaVladis [17]

The use of chemicals on crops poses known health risks to humans. this statement most support a decision to buy organic produce.

  • The agriculture industry has become more industrialized, which has increased the chemical load on the environment.
  • Agrochemicals known as pesticides are applied to agricultural fields, public health initiatives, and urban green spaces to protect people and plants from numerous diseases.
  • Their side effects, however, can be a significant environmental health risk factor due to their proven capacity to have a wide range of detrimental health and environmental impacts.
  • Produce that is organic uses fewer pesticides.
  • Because organic food lacks preservatives that extend its shelf life, it is frequently fresher.
  • Organic farming typically benefits the environment.
  • Animals kept organically are not fed animal byproducts, growth hormones, or antibiotics.

learn more about  organic produce here: brainly.com/question/14318031

#SPJ1

5 0
1 year ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which term describes organisms that live on or in the ocean floor?
    10·2 answers
  • The nervous system contributes to the success of birds as flying animals because of
    13·1 answer
  • Spherical bacteria that divide and remain attached in chainlike patterns are called __________.
    6·1 answer
  • Which change of state occurs at 100 °C when heat energy has been added to liquid water?
    5·2 answers
  • Which of the following is true
    15·1 answer
  • What happens when both numerator and denominator are negative?
    5·1 answer
  • A type of organism that no longer exist on earth is said to be
    9·2 answers
  • 1) What type of reproduction is illustrated above?
    9·2 answers
  • Explain how one of the earth’s natural processes is responsible for creating a natural resource.
    10·1 answer
  • Ucx/fnfp/nay can clear doubrs physics ​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!