1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
2 years ago
10

Cual es la función de la célula eucariota

Biology
2 answers:
MakcuM [25]2 years ago
8 0

Answer:

trabajar juntos para modificar, empaquetar y transportar lípidos y proteínas

Explanation:

Svetradugi [14.3K]2 years ago
6 0

Answer:

Las células eucariotas tienen dos funciones primordiales, alimentarse y reproducirse. Las células eucariotas, al igual que las procariotas, llevan a cabo tres funciones esenciales: la nutrición, la relación con el medio y la reproducción. ... Célula con un núcleo definido por una membrana que contiene el material genético.

Explanation:

You might be interested in
Which of the following gases is formed during photosynthesis?
katrin2010 [14]

Answer:

oxygen

Explanation:

6 0
2 years ago
What kind of reaction adds water to break large bio molecules into subunits
Romashka-Z-Leto [24]
This is called hydrolysis .
8 0
3 years ago
Read 2 more answers
3 interesting facts about a stroke
melamori03 [73]

Answer:

1. Someone in the United States has a stroke every 40 seconds. 

2. Every year, more than 795,000 people in the United States have a stroke.

3. In the year of 2018, 1 in every 6 deaths from cardiovascular disease was due to stroke.

7 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
I will give you brainliest What is the most important organ in the human body?
Shtirlitz [24]

Answer: Its the brain because it controls everything in your body

Explanation:

Have great day

7 0
2 years ago
Read 2 more answers
Other questions:
  • Ostealgia is ________.
    11·1 answer
  • In angiosperms, pollen grains develop in the ________ and land on the ________.
    7·1 answer
  • Sister chromatids separate (and are now called chromosomes) and begin to move toward the poles of the cell. This happens in
    6·1 answer
  • True or False: The following example populations meet the basic requirements of Hardy-Weinberg equilibrium. a. A small, isolated
    5·1 answer
  • What are 3 limiting factors that can prevent a population from increasing?
    14·1 answer
  • Help me with this picture please
    6·2 answers
  • The following quote makes an important distinction between renewable and nonrenewable resources.
    6·1 answer
  • Acciones saludables y no saludables
    15·2 answers
  • Once the DNA strand unwinds and is modified; it sent through the
    7·1 answer
  • (GIVING BRAINLIEST!!!!!!!!!!!!!!!!!!!!!)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!