1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
8

1. the sodium atom .....

Biology
2 answers:
Vinil7 [7]3 years ago
3 0

Answer:

Sodium Chloride (NaCl)

maxonik [38]3 years ago
3 0
An ionic bond or an ionic compound because an anion and cation come together, which make a bond/compound.
You might be interested in
Which of the following is an example of natural selection?
Alexxx [7]

Answer:

A) Hummingbirds drinking nectar from a plant.

Step-by-step explanation:

Here are some examples of natural selection: In a habitat there are red bugs and green bugs. The birds prefer the taste of the red bugs, so soon there are many green bugs and few red bugs. The green bugs reproduce and make more green bugs and eventually there are no more red bugs.

8 0
3 years ago
Read 2 more answers
Learning Task 1: WORD UP
HACTEHA [7]

The words for the descriptions are food chain, trophic level, energy pyramid, high diversity, low diversity, etc. respectively.

<h3>Ecology</h3>
  • The feeding relationship that exists among organisms is termed the food chain.

  • Each step in the transfer of energy and matter in a community is termed the trophic level.

  • A community or group of living organisms that live in and interact with each other in a specific environment is termed an ecosystem.

  • A diagram that compares the energy used by producers, primary consumers, and other trophic levels is known as the energy pyramid.

  • An ecosystem with a high number of species is said to be of high diversity.

  • An ecosystem with a few prominent species and a low number of other species is said to be of low diversity.

  • Organisms that feed on and break down organic matter are said to be decomposers.

  • Organisms that can make their own food in the ecosystem are termed, producers.

  • Animals that feed on flesh are called carnivores.

  • A system of interlocking and interdependent food chains is called a food web.

More on ecology can be found here: brainly.com/question/13046612

#SPJ1

7 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
The term that fungi that decompose dead organic matter :
Yanka [14]
Since most fungi and decomposers are Saptotrops, The answer is most likely A; Saprobic.
8 0
3 years ago
Read 2 more answers
A version of a gene
Inga [223]

Different versions of a gene are called alleles. Alleles are described as either dominant or recessive depending on their associated traits.

4 0
3 years ago
Other questions:
  • Which is not an accurate classification of the python<br>A. Invasive<br>B. Native<br>C. Introduced
    8·1 answer
  • What is a earthquake?
    8·1 answer
  • Select all that apply.
    9·1 answer
  • If the Polymerase Chain Reaction process or PCR were a machine, what kind do you think it would it be? A a printer B a shredder
    13·2 answers
  • What is the longest period of time anyone has gone without oxygen
    6·2 answers
  • How much force is needed to make a 12 kg object accelerate at 3 m/s
    14·1 answer
  • PLEASE HELP! .......................
    6·1 answer
  • Which of the following best describes
    14·1 answer
  • After they investigated further, they discovered that the difference between lactose tolerant and intolerant individuals was due
    7·1 answer
  • Explain in detail what transpiration is and how it affects the flora of the earth.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!